GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2019-10-23 00:57:36, GGGenome : P. pacificus genome, WUGSC 5.0/priPac1 (Feb, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chrUn:3435187-3435201
AAAAAATATCATTTTTTTCAGAATTTCAGA3435187AATGTTGTCAATGAATATATCTCTGACCTGGAGAACGCTATAAAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/priPac1/TTCATTGACAACATT
lang : en | db : priPac1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.005 | 0.005 | search_start;
0.077 | 0.072 | search_plus_done; http://172.18.8.76:28112/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.007 | search_minus_done; http://172.18.8.76:28112/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).