GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-07-17 02:01:25, GGGenome : RefSeq complete RNA release 90 (Sep, 2018)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Agaricus bisporus var. bisporus H97 ATP2 beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase (AGABI2DRAFT_190409), mRNA
XM_006457965.1:1000-1014
CGTGATGAAGAAGGTCAGGATGTGTTGCTC1000TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Cordyceps militaris CM01 ATP synthase beta chain (CCM_07426), partial mRNA
XM_006672567.1:871-885
CGTGATGAGGAAGGTCAGGACGTGCTGCTC871TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGTTCTGAGGTG
Batrachochytrium dendrobatidis JAM81 hypothetical protein (BATDEDRAFT_20257), mRNA
XM_006680239.1:854-868
CGTGATCAAGAAGGCCAGGATGTGTTGCTT854TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
PREDICTED: Neolamprologus brichardi homeobox protein engrailed-1-like (LOC102789766), mRNA
XM_006806441.1:359-373
GCCCAACAGGCCCACAGAACCACCAACTTT359TTCATTGACAACATTTTGAGACCGGACTTTGGCTGCAAGAAGGAG
PREDICTED: Neolamprologus brichardi histone-lysine N-methyltransferase SUV39H1-like (LOC102791492), mRNA
XM_006807165.1:1030-1044
TGTAACCCTAACCTGCAGGTATACAACGTG1030TTCATTGACAACATTGACGAAAGGCTTCCGAGAATTGCGTTATTT
PREDICTED: Chrysochloris asiatica coronin, actin binding protein, 2B (CORO2B), mRNA
XM_006866553.1:277-291
GGCAACGTGCTGGACATCAAGTGGAACCCC277TTCATTGACAACATTATCGCCTCATGTTCAGAGGACACCTCCGTG
Tremella mesenterica DSM 1558 hypothetical protein (TREMEDRAFT_41300), mRNA
XM_007008209.1:1032-1046
CGTGACGAAGAGGGTCAGGATGTGTTGCTC1032TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
PREDICTED: Balaenoptera acutorostrata scammoni dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_007188253.1:6387-6401
ATCATCAGGGTGAAGTTGGCTAGTTGCGGC6387TTCATTGACAACATTGTTTTGGCCAGGAAGTTTTTCACGCTCTAC
Agaricus bisporus var. burnettii JB137-S8 ATP2 beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase (AGABI1DRAFT_111188), mRNA
XM_007326499.1:1000-1014
CGTGATGAAGAAGGTCAGGATGTGTTGCTC1000TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Melampsora larici-populina 98AG31 hypothetical protein (MELLADRAFT_45062), mRNA
XM_007415010.1:1070-1084
CGTGACGAAGAGGGACAAGATGTGCTTTTG1070TTCATTGACAACATTTTCCGATTCACCCAAGCTGGTTCCGAGGTA
Coniophora puteana RWD-64-598 SS2 ATP synthase F1 beta subunit mRNA
XM_007766058.1:968-982
CGTGACGAGGAGGGCCAGGACGTGCTTCTG968TTCATTGACAACATTTTCCGCTTCACGCAAGCCGGTTCCGAGGTA
Coniophora puteana RWD-64-598 SS2 hypothetical protein partial mRNA
XM_007775178.1:2305-2319
ATGAACGAAGTCAAAGAGTCGGCTCAAAGC2305TTCATTGACAACATTCAGAGGAGAACGGTCTTTGTTTCCCAAAAC
Endocarpon pusillum Z07020 ATP synthase subunit beta mRNA
XM_007802133.1:979-993
CGTGACGAGGAAGGACAGGACGTGCTGCTC979TTCATTGACAACATTTTCCGATTCACCCAGGCTGGTTCTGAGGTG
Metarhizium acridum CQMa 102 ATP synthase beta chain precursor partial mRNA
XM_007816203.1:1081-1095
CGTGACCAGGAAGGCCAGGATGTGCTGCTC1081TTCATTGACAACATTTTCCGATTCACTCAGGCCGGCTCTGAGGTG
Pestalotiopsis fici W106-1 ATP synthase subunit beta mRNA
XM_007837839.1:871-885
CGTGACGCCGAGGGACAGGATGTGCTGCTC871TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
PREDICTED: Eptesicus fuscus dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_008151678.1:6367-6381
ATCATAAGAGTGAAGCTGGCTAGCTGTGGC6367TTCATTGACAACATTGTGTTGGCCAGGAAGTTTTTCACGCTCTAC
PREDICTED: Stegastes partitus homeobox protein engrailed-1-like (LOC103355596), transcript variant X1, mRNA
XM_008279450.1:396-410
GCTCAGCAGGCCCACAGAACCACCAACTTT396TTCATTGACAACATTTTGCGACCGGACTTCGGCTGTAAAAAGGAG
PREDICTED: Stegastes partitus homeobox protein engrailed-1-like (LOC103355596), transcript variant X2, mRNA
XM_008279451.1:396-410
GCTCAGCAGGCCCACAGAACCACCAACTTT396TTCATTGACAACATTTTGCGACCGGACTTCGGCTGTAAAAAGGAG
PREDICTED: Equus przewalskii activating signal cointegrator 1 complex subunit 1 (ASCC1), transcript variant X1, mRNA
XM_008539341.1:744-758
TGTGAGATGCTACAGCAGTGTAAAGAGGAA744TTCATTGACAACATTTGTGGGGGCAAACCCCTGGAAGTAGAGATG
PREDICTED: Equus przewalskii activating signal cointegrator 1 complex subunit 1 (ASCC1), transcript variant X2, mRNA
XM_008539342.1:742-756
TGTGAGATGCTACAGCAGTGTAAAGAGGAA742TTCATTGACAACATTTGTGGGGGCAAACCCCTGGAAGTAGAGATG
PREDICTED: Ursus maritimus dynein, axonemal, heavy chain 5 (DNAH5), transcript variant X1, mRNA
XM_008689897.1:6457-6471
ATCATAAGGGTGAAGCTGGCTAGTTGTGGC6457TTCATTGACAACATTGTGTTGGCCAGGAAGTTTTTCACACTCTAC
PREDICTED: Ursus maritimus dynein, axonemal, heavy chain 5 (DNAH5), transcript variant X2, mRNA
XM_008689898.1:6451-6465
ATCATAAGGGTGAAGCTGGCTAGTTGTGGC6451TTCATTGACAACATTGTGTTGGCCAGGAAGTTTTTCACACTCTAC
Cyphellophora europaea CBS 101466 ATP synthase subunit beta, mitochondrial partial mRNA
XM_008715668.1:1486-1500
AGAGACGAAGAAGGTCAAGATGTGTTGCTC1486TTCATTGACAACATTTTCCGCTTCACTCAGGCCGGTTCTGAAGTG
Wallemia ichthyophaga EXF-994 hypothetical protein partial mRNA
XM_009268544.1:907-921
CGTGACGATGAAGGTCAAGATGTCTTGCTC907TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCTGAAGTT
Heterobasidion irregulare TC 32-1 beta subunit of putative F0F1-type ATP synthase mRNA
XM_009544597.1:984-998
CGTGATGAGGAAGGTCAGGATGTGTTGCTC984TTCATTGACAACATTTTCCGCTTCACTCAGGCCGGTTCCGAGGTG
PREDICTED: Cariama cristata ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B), partial mRNA
XM_009697087.1:619-633
AGGGACCAGGAGGGTCAGGACGTGCTGCTC619TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGCTCAGAGGTG
Neurospora tetrasperma FGSC 2508 H+-transporting ATP synthase beta chain mRNA
XM_009854061.1:982-996
CGTGATGAGGAGGGTCAGGATGTGTTGCTC982TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Nicotiana sylvestris ATP synthase subunit beta, mitochondrial-like (LOC104229400), mRNA
NM_001302565.1:993-1007
AGAGATGCTGAGGGGCAGGATGTGCTTCTC993TTCATTGACAACATTTTCAGATTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Populus euphratica ATP synthase subunit beta, mitochondrial-like (LOC105124531), mRNA
XM_011024585.1:1120-1134
CGTGATGCTGAAGGGCAAGATGTGCTTCTC1120TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Populus euphratica uncharacterized LOC105127860 (LOC105127860), mRNA
XM_011029320.1:5024-5038
CTCCCAGTTTGTGAACCATTATCTAGACGA5024TTCATTGACAACATTGAGAAGCCAAAAGTTCAGCAGCTAATCAGT
PREDICTED: Populus euphratica ATP synthase subunit beta, mitochondrial (LOC105135509), mRNA
XM_011040401.1:1087-1101
CGTGATGCTGAAGGGCAAGATGTGCTTCTA1087TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Populus euphratica ATP synthase subunit beta, mitochondrial-like (LOC105119519), mRNA
XM_011017661.1:1124-1138
CGTGATGCTGAAGGGCAAGATGTGCTTCTC1124TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Bactrocera cucurbitae ATP synthase subunit beta, mitochondrial (LOC105219929), mRNA
XM_011196280.1:889-903
CGTGATCAGGAGGGACAAGATGTACTGCTT889TTCATTGACAACATTTTCCGCTTCACCCAAGCTGGTTCAGAAGTG
PREDICTED: Bactrocera cucurbitae ATP synthase subunit beta, mitochondrial-like (LOC105220561), partial mRNA
XM_011197006.1:905-919
CGTGATCAGGAGGGACAAGATGTACTGCTT905TTCATTGACAACATTTTCCGCTTCACCCAAGCTGGTTCAGAAGTG
Capsaspora owczarzaki ATCC 30864 ATP synthase subunit beta mRNA
XM_004364639.2:980-994
CGTGACGAGGAAGGCCAGGATGTGCTGCTC980TTCATTGACAACATTTTCCGCTTCACCCAGGCCGGTTCCGAGGTG
Metarhizium robertsii ARSEF 23 ATP synthase beta chain mRNA
XM_007823312.1:871-885
CGTGACCAGGAAGGCCAGGATGTGCTACTC871TTCATTGACAACATTTTCCGATTCACTCAGGCCGGTTCTGAGGTG
PREDICTED: Fragaria vesca subsp. vesca chlorophyll a-b binding protein CP29.2, chloroplastic (LOC101309848), mRNA
XM_004302588.2:607-621
GTCGTCTTACTTGGGACAGCCGCTTCCATT607TTCATTGACAACATTGATCTGGATCGAGGTTCTGGTGATCGGCTA
PREDICTED: Takifugu rubripes ankyrin repeat domain-containing protein 33B-like (LOC101077638), mRNA
XM_003967911.2:2369-2383
TATATTTTTATAATACAGATTATAATTCTT2369TTCATTGACAACATTTCATTTTCTATTCAAAGTGGATTTTTTCAC
PREDICTED: Cucumis sativus ATP synthase subunit beta, mitochondrial-like (LOC101205618), mRNA
XM_004150625.2:1057-1071
CGTGATGCTGAAGGACAGGATGTGCTTCTC1057TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Gossypium raimondii ATP synthase subunit beta, mitochondrial (LOC105779299), mRNA
XM_012603054.1:1071-1085
CGTGATGCTGAAGGGCAGGATGTGCTTCTC1071TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTCTGAAGTG
PREDICTED: Gossypium raimondii ATP synthase subunit beta, mitochondrial-like (LOC105779300), mRNA
XM_012603055.1:1066-1080
CGTGATGCAGAAGGGCAGGATGTGCTTCTC1066TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTCTGAAGTG
Colletotrichum graminicola M1.001 ATP synthase F1 partial mRNA
XM_008098766.1:871-885
CGTGACGAAGAAGGACAGGATGTGTTGCTC871TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Acytostelium subglobosum LB1 hypothetical protein partial mRNA
XM_012904189.1:769-783
GTGATGGAGCTACAGTCATCGGATAGAAGG769TTCATTGACAACATTATCAACACAATCAATGATCCACAGCAGCAG
Schistosoma haematobium Cyclin-dependent kinase 16 mRNA
XM_012936972.1:147-161
AGAAGAAGAAATTGAAAGCGAAGAATTCAA147TTCATTGACAACATTTCAATCATGTACTACCGAACAGGAGAATTT
Schistosoma haematobium hypothetical protein mRNA
XM_012937928.1:909-923
TACAAGAAATAATTCTTCATTGAACATGCA909TTCATTGACAACATTTGCATTGAAACAAAATAATCTATCTTTCAT
PREDICTED: Dipodomys ordii dynein, axonemal, heavy chain 5 (Dnah5), mRNA
XM_013013842.1:6541-6555
ATCATCAGGGTGAAGTTGGCCAGTTGTGGC6541TTCATTGACAACATTGTTCTAGCCAGGAAGTTTTTCACACTCTAC
Schizosaccharomyces octosporus yFS286 F1-ATPase beta subunit Atp2 mRNA
XM_013160621.1:1022-1036
CGTGACGTTGAAGGTCAAGATGTCTTGTTC1022TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCTGAGGTG
PREDICTED: Papilio polytes ATP synthase subunit beta, mitochondrial (LOC106104691), partial mRNA
XM_013284821.1:682-696
CGTGATCAGGAGGGTCAGGATGTACTGCTC682TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGTTCTGAGGTG
PREDICTED: Papilio xuthus ATP synthase subunit beta, mitochondrial-like (LOC106115960), mRNA
XM_013309627.1:981-995
CGTGACCAGGAGGGTCAGGATGTGCTGCTC981TTCATTGACAACATTTTCCGTTTCACTCAAGCCGGTTCTGAAGTG
PREDICTED: Amyelois transitella ATP synthase subunit beta, mitochondrial (LOC106134642), mRNA
XM_013334736.1:973-987
CGCGACCAAGAAGGACAGGATGTGCTACTT973TTCATTGACAACATTTTCCGTTTCACCCAAGCTGGGTCAGAAGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/refseq90/TTCATTGACAACATT
lang : en | db : refseq90 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.202 | 0.195 | search_plus_done; http://172.18.8.74:28003/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.239 | 0.037 | search_minus_done; http://172.18.8.74:28003/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.239 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).