GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2019-07-19 06:48:16, GGGenome : RefSeq complete RNA release 94 (May, 2019)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Nicotiana sylvestris ATP synthase subunit beta, mitochondrial-like (LOC104229400), mRNA
NM_001302565.1:993-1007
AGAGATGCTGAGGGGCAGGATGTGCTTCTC993TTCATTGACAACATTTTCAGATTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Takifugu rubripes ankyrin repeat domain-containing protein 33B-like (LOC101077638), mRNA
XM_003967911.2:2369-2383
TATATTTTTATAATACAGATTATAATTCTT2369TTCATTGACAACATTTCATTTTCTATTCAAAGTGGATTTTTTCAC
PREDICTED: Cucumis sativus ATP synthase subunit beta, mitochondrial-like (LOC101205618), mRNA
XM_004150625.2:1057-1071
CGTGATGCTGAAGGACAGGATGTGCTTCTC1057TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Fragaria vesca subsp. vesca chlorophyll a-b binding protein CP29.2, chloroplastic (LOC101309848), mRNA
XM_004302588.2:607-621
GTCGTCTTACTTGGGACAGCCGCTTCCATT607TTCATTGACAACATTGATCTGGATCGAGGTTCTGGTGATCGGCTA
Capsaspora owczarzaki ATCC 30864 ATP synthase subunit beta mRNA
XM_004364639.2:980-994
CGTGACGAGGAAGGCCAGGATGTGCTGCTC980TTCATTGACAACATTTTCCGCTTCACCCAGGCCGGTTCCGAGGTG
Agaricus bisporus var. bisporus H97 ATP2 beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase (AGABI2DRAFT_190409), mRNA
XM_006457965.1:1000-1014
CGTGATGAAGAAGGTCAGGATGTGTTGCTC1000TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Cordyceps militaris CM01 ATP synthase beta chain (CCM_07426), partial mRNA
XM_006672567.1:871-885
CGTGATGAGGAAGGTCAGGACGTGCTGCTC871TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGTTCTGAGGTG
Batrachochytrium dendrobatidis JAM81 hypothetical protein (BATDEDRAFT_20257), mRNA
XM_006680239.1:854-868
CGTGATCAAGAAGGCCAGGATGTGTTGCTT854TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
PREDICTED: Neolamprologus brichardi homeobox protein engrailed-1-like (LOC102789766), mRNA
XM_006806441.1:359-373
GCCCAACAGGCCCACAGAACCACCAACTTT359TTCATTGACAACATTTTGAGACCGGACTTTGGCTGCAAGAAGGAG
PREDICTED: Neolamprologus brichardi histone-lysine N-methyltransferase SUV39H1-like (LOC102791492), mRNA
XM_006807165.1:1030-1044
TGTAACCCTAACCTGCAGGTATACAACGTG1030TTCATTGACAACATTGACGAAAGGCTTCCGAGAATTGCGTTATTT
PREDICTED: Chrysochloris asiatica coronin, actin binding protein, 2B (CORO2B), mRNA
XM_006866553.1:277-291
GGCAACGTGCTGGACATCAAGTGGAACCCC277TTCATTGACAACATTATCGCCTCATGTTCAGAGGACACCTCCGTG
Tremella mesenterica DSM 1558 hypothetical protein (TREMEDRAFT_41300), mRNA
XM_007008209.1:1032-1046
CGTGACGAAGAGGGTCAGGATGTGTTGCTC1032TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
Agaricus bisporus var. burnettii JB137-S8 ATP2 beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase (AGABI1DRAFT_111188), mRNA
XM_007326499.1:1000-1014
CGTGATGAAGAAGGTCAGGATGTGTTGCTC1000TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Melampsora larici-populina 98AG31 hypothetical protein (MELLADRAFT_45062), mRNA
XM_007415010.1:1070-1084
CGTGACGAAGAGGGACAAGATGTGCTTTTG1070TTCATTGACAACATTTTCCGATTCACCCAAGCTGGTTCCGAGGTA
Coniophora puteana RWD-64-598 SS2 ATP synthase F1 beta subunit mRNA
XM_007766058.1:968-982
CGTGACGAGGAGGGCCAGGACGTGCTTCTG968TTCATTGACAACATTTTCCGCTTCACGCAAGCCGGTTCCGAGGTA
Coniophora puteana RWD-64-598 SS2 hypothetical protein partial mRNA
XM_007775178.1:2305-2319
ATGAACGAAGTCAAAGAGTCGGCTCAAAGC2305TTCATTGACAACATTCAGAGGAGAACGGTCTTTGTTTCCCAAAAC
Endocarpon pusillum Z07020 ATP synthase subunit beta mRNA
XM_007802133.1:979-993
CGTGACGAGGAAGGACAGGACGTGCTGCTC979TTCATTGACAACATTTTCCGATTCACCCAGGCTGGTTCTGAGGTG
Metarhizium acridum CQMa 102 ATP synthase beta chain precursor partial mRNA
XM_007816203.1:1081-1095
CGTGACCAGGAAGGCCAGGATGTGCTGCTC1081TTCATTGACAACATTTTCCGATTCACTCAGGCCGGCTCTGAGGTG
Metarhizium robertsii ARSEF 23 ATP synthase beta chain mRNA
XM_007823312.1:871-885
CGTGACCAGGAAGGCCAGGATGTGCTACTC871TTCATTGACAACATTTTCCGATTCACTCAGGCCGGTTCTGAGGTG
Pestalotiopsis fici W106-1 ATP synthase subunit beta mRNA
XM_007837839.1:871-885
CGTGACGCCGAGGGACAGGATGTGCTGCTC871TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Colletotrichum graminicola M1.001 ATP synthase F1 partial mRNA
XM_008098766.1:871-885
CGTGACGAAGAAGGACAGGATGTGTTGCTC871TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
PREDICTED: Stegastes partitus homeobox protein engrailed-1-like (LOC103355596), transcript variant X1, mRNA
XM_008279450.1:396-410
GCTCAGCAGGCCCACAGAACCACCAACTTT396TTCATTGACAACATTTTGCGACCGGACTTCGGCTGTAAAAAGGAG
PREDICTED: Stegastes partitus homeobox protein engrailed-1-like (LOC103355596), transcript variant X2, mRNA
XM_008279451.1:396-410
GCTCAGCAGGCCCACAGAACCACCAACTTT396TTCATTGACAACATTTTGCGACCGGACTTCGGCTGTAAAAAGGAG
PREDICTED: Equus przewalskii activating signal cointegrator 1 complex subunit 1 (ASCC1), transcript variant X1, mRNA
XM_008539341.1:744-758
TGTGAGATGCTACAGCAGTGTAAAGAGGAA744TTCATTGACAACATTTGTGGGGGCAAACCCCTGGAAGTAGAGATG
PREDICTED: Equus przewalskii activating signal cointegrator 1 complex subunit 1 (ASCC1), transcript variant X2, mRNA
XM_008539342.1:742-756
TGTGAGATGCTACAGCAGTGTAAAGAGGAA742TTCATTGACAACATTTGTGGGGGCAAACCCCTGGAAGTAGAGATG
PREDICTED: Ursus maritimus dynein, axonemal, heavy chain 5 (DNAH5), transcript variant X1, mRNA
XM_008689897.1:6457-6471
ATCATAAGGGTGAAGCTGGCTAGTTGTGGC6457TTCATTGACAACATTGTGTTGGCCAGGAAGTTTTTCACACTCTAC
PREDICTED: Ursus maritimus dynein, axonemal, heavy chain 5 (DNAH5), transcript variant X2, mRNA
XM_008689898.1:6451-6465
ATCATAAGGGTGAAGCTGGCTAGTTGTGGC6451TTCATTGACAACATTGTGTTGGCCAGGAAGTTTTTCACACTCTAC
Cyphellophora europaea CBS 101466 ATP synthase subunit beta, mitochondrial partial mRNA
XM_008715668.1:1486-1500
AGAGACGAAGAAGGTCAAGATGTGTTGCTC1486TTCATTGACAACATTTTCCGCTTCACTCAGGCCGGTTCTGAAGTG
Wallemia ichthyophaga EXF-994 hypothetical protein partial mRNA
XM_009268544.1:907-921
CGTGACGATGAAGGTCAAGATGTCTTGCTC907TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCTGAAGTT
Heterobasidion irregulare TC 32-1 beta subunit of putative F0F1-type ATP synthase mRNA
XM_009544597.1:984-998
CGTGATGAGGAAGGTCAGGATGTGTTGCTC984TTCATTGACAACATTTTCCGCTTCACTCAGGCCGGTTCCGAGGTG
PREDICTED: Cariama cristata ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B), partial mRNA
XM_009697087.1:619-633
AGGGACCAGGAGGGTCAGGACGTGCTGCTC619TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGCTCAGAGGTG
Neurospora tetrasperma FGSC 2508 H+-transporting ATP synthase beta chain mRNA
XM_009854061.1:982-996
CGTGATGAGGAGGGTCAGGATGTGTTGCTC982TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
PREDICTED: Populus euphratica ATP synthase subunit beta, mitochondrial-like (LOC105119519), mRNA
XM_011017661.1:1124-1138
CGTGATGCTGAAGGGCAAGATGTGCTTCTC1124TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Populus euphratica ATP synthase subunit beta, mitochondrial-like (LOC105124531), mRNA
XM_011024585.1:1120-1134
CGTGATGCTGAAGGGCAAGATGTGCTTCTC1120TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Populus euphratica uncharacterized LOC105127860 (LOC105127860), mRNA
XM_011029320.1:5024-5038
CTCCCAGTTTGTGAACCATTATCTAGACGA5024TTCATTGACAACATTGAGAAGCCAAAAGTTCAGCAGCTAATCAGT
PREDICTED: Populus euphratica ATP synthase subunit beta, mitochondrial (LOC105135509), mRNA
XM_011040401.1:1087-1101
CGTGATGCTGAAGGGCAAGATGTGCTTCTA1087TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Gossypium raimondii ATP synthase subunit beta, mitochondrial (LOC105779299), mRNA
XM_012603054.1:1071-1085
CGTGATGCTGAAGGGCAGGATGTGCTTCTC1071TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTCTGAAGTG
PREDICTED: Gossypium raimondii ATP synthase subunit beta, mitochondrial-like (LOC105779300), mRNA
XM_012603055.1:1066-1080
CGTGATGCAGAAGGGCAGGATGTGCTTCTC1066TTCATTGACAACATTTTCCGTTTTACTCAAGCAAACTCTGAAGTG
Acytostelium subglobosum LB1 hypothetical protein partial mRNA
XM_012904189.1:769-783
GTGATGGAGCTACAGTCATCGGATAGAAGG769TTCATTGACAACATTATCAACACAATCAATGATCCACAGCAGCAG
Schistosoma haematobium Cyclin-dependent kinase 16 mRNA
XM_012936972.1:147-161
AGAAGAAGAAATTGAAAGCGAAGAATTCAA147TTCATTGACAACATTTCAATCATGTACTACCGAACAGGAGAATTT
Schistosoma haematobium hypothetical protein mRNA
XM_012937928.1:909-923
TACAAGAAATAATTCTTCATTGAACATGCA909TTCATTGACAACATTTGCATTGAAACAAAATAATCTATCTTTCAT
PREDICTED: Dipodomys ordii dynein, axonemal, heavy chain 5 (Dnah5), mRNA
XM_013013842.1:6541-6555
ATCATCAGGGTGAAGTTGGCCAGTTGTGGC6541TTCATTGACAACATTGTTCTAGCCAGGAAGTTTTTCACACTCTAC
Schizosaccharomyces octosporus yFS286 F1-ATPase beta subunit Atp2 mRNA
XM_013160621.1:1022-1036
CGTGACGTTGAAGGTCAAGATGTCTTGTTC1022TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCTGAGGTG
PREDICTED: Papilio polytes ATP synthase subunit beta, mitochondrial (LOC106104691), partial mRNA
XM_013284821.1:682-696
CGTGATCAGGAGGGTCAGGATGTACTGCTC682TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGTTCTGAGGTG
PREDICTED: Papilio xuthus ATP synthase subunit beta, mitochondrial-like (LOC106115960), mRNA
XM_013309627.1:981-995
CGTGACCAGGAGGGTCAGGATGTGCTGCTC981TTCATTGACAACATTTTCCGTTTCACTCAAGCCGGTTCTGAAGTG
PREDICTED: Amyelois transitella ATP synthase subunit beta, mitochondrial (LOC106134642), mRNA
XM_013334736.1:973-987
CGCGACCAAGAAGGACAGGATGTGCTACTT973TTCATTGACAACATTTTCCGTTTCACCCAAGCTGGGTCAGAAGTG
Exophiala aquamarina CBS 119918 ATP synthase subunit beta, mitochondrial partial mRNA
XM_013402041.1:883-897
CGTGACGAAGAAGGACAGGATGTGTTGCTC883TTCATTGACAACATTTTCCGTTTCACTCAAGCCGGTTCCGAAGTA
Aureobasidium subglaciale EXF-2481 hypothetical protein mRNA
XM_013491984.1:1147-1161
CGTGACGAGGAGGGTCAGGATGTGCTTCTC1147TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Aureobasidium namibiae CBS 147.97 ATP synthase F1, beta subunit partial mRNA
XM_013575907.1:871-885
CGTGACGAGGAGGGTCAGGATGTGCTTCTC871TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
PREDICTED: Brassica oleracea var. oleracea ATP synthase subunit beta-1, mitochondrial-like (LOC106327128), mRNA
XM_013765194.1:1026-1040
CGTGATGCCGAGGGCCAAGATGTGTTGCTT1026TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/refseq94/TTCATTGACAACATT
lang : en | db : refseq94 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.316 | 0.310 | search_plus_done; http://172.18.8.74:27494/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.482 | 0.166 | search_minus_done; http://172.18.8.74:27494/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.482 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).