GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-04-05 08:51:26, GGGenome : Golden snub-nosed monkey genome, Rrox_v1/rhiRox1 (Oct, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

KN294281v1:341348-341362
CAGAATATATTATCGCTTTGAACACAGATT341348TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
KN294758v1:2884588-2884602
TCTGGGTATAATGCACTGACCTGCTGATCT2884588TTCATTGACAACATTGCCATTGACCTTGGAGCTGGAAAGGCCCTC
KN296609v1:1832929-1832943
GCCTCTGGGCCTATGTTAGATGGGCCATGC1832929TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
KN297845v1:3222642-3222656
GCCTGAGCCACCATGCCCAGCTTGCTATTC3222642TTCATTGACAACATTCACTTAAACAAACAAACAAACAAACATCCA
KN298262v1:886744-886758
GAGCCACCATGCCCAGCCTATCTTAGCTTT886744TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
KN298705v1:546394-546408
TTCGGACCCCCAAATCAGTCTTCATATTCT546394TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAAACAGAATT
KN299722v1:561992-562006
CCCCTCCAAGAGTGGTATTTTTTAATGTGG561992TTCATTGACAACATTTTCTCTAGCAATTTTTGTTTTGTCTGGATT
KN299743v1:518392-518406
TTAAGTCTTATTAACTTAAGTTGCTATTAT518392TTCATTGACAACATTAATAACTGTATAACAAACTATGCAAGCTTC
KN294991v1:675252-675266
GCCTGTTTTTCATATGCATATGTAATAGGG675252AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
KN295217v1:207841-207855
GAATGCTTAAAATAATGGCTCTACAACTTT207841AATGTTGTCAATGAAAAGAGTTAAACTGTAAAATATTTGAAGAGA
KN295758v1:112137-112151
ATGTAGTCAGCAAATAGTTAATTGCTGTTT112137AATGTTGTCAATGAAAAGGAGGGTTACACAAAATCAGAGGTTTTA
KN296180v1:2137533-2137547
ATACCTGTCTGCTAACAAAATTAATTTCAG2137533AATGTTGTCAATGAATGAAGTGCATGTTCTCTACTGTTTATGAGA
KN297112v1:4972869-4972883
TGAAATTAGAGTAAGTTTTCCTGTGGAAAC4972869AATGTTGTCAATGAATGTGGGTGTCCACTGTAGAGTGCTGTAGCT
KN298213v1:679470-679484
TGGAGTAGAGGGCGGAAACTCATGCCCAGC679470AATGTTGTCAATGAAAGTCAACACAGTAGGGGAAAAAAAATGGGG
KN298690v1:388140-388154
GTTTGCTCTATTCACTGTCCTCAATGGTAG388140AATGTTGTCAATGAACAAGACATATCTATGTTCCTGGAAACTCAA
KN300200v1:1227961-1227975
GTTGTCACCTCAGTGTGAGTTACCTCAGGC1227961AATGTTGTCAATGAATAGAGCCTCCAGGGAGAACCTCCAGACTGC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/rhiRox1/TTCATTGACAACATT
lang : en | db : rhiRox1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.005 | 0.005 | search_start;
0.112 | 0.107 | search_plus_done; http://172.18.8.78:28761/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.122 | 0.010 | search_minus_done; http://172.18.8.78:28761/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.129 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).