GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-26 05:07:55, GGGenome : Rice genome, Os-Nipponbare-Reference-IRGSP-1.0 (Oct, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr03:9682664-9682678
TGATCCCAATAGTTGTTTATTTTTGGACTC9682664TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
chr07:12705943-12705957
CGTGTGCCTCCTGGATGCACCAATCGGCTG12705943TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
chr07:24274176-24274190
AGATCTATCTAATTTAGGTGTAGTGCTCTC24274176TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
chr09:16180672-16180686
CTTTCAAATGATGGTCAAACTAATTATAAA16180672TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
chr10:2282429-2282443
ACAAATATATTCACAATATTGATTCACAGG2282429TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
chr02:31045654-31045668
GAGCAAGCCATGAATCGGTACAAACAAGAG31045654AATGTTGTCAATGAACAGGTCTTATCCACACGTCGGACATCAGGA
chr05:7954307-7954321
TATGATTGAGCACCCCTACCTACTTTGCAA7954307AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
chr05:27511242-27511256
TCTTGCATAAATTACCTGAGTGAAACGGAA27511242AATGTTGTCAATGAACAAAAGCACATCTTGTCCTTCGGCATCACG
chr10:4470091-4470105
CCTCCATAAGCAATGCCTCTTTTCCCTATC4470091AATGTTGTCAATGAATGTTTTAGGCAGCTGCAAAGTTGTCACACC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/rice/TTCATTGACAACATT
lang : en | db : rice | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.72:28219/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.006 | search_minus_done; http://172.18.8.72:28219/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.086 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).