GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:48:14, GGGenome : Shrew genome, Broad/sorAra2 (Aug, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH798150:13233852-13233866
ATATTATTCAGTAGCATTCAAAGAAAATGA13233852TTCATTGACAACATTGTAGCATCAAACATCTTGCATTTCCTTTAT
JH798155:28556841-28556855
GGCACTATTGCAGCAACGTGGGAAGGTGCC28556841TTCATTGACAACATTGATGAGGAATATGATCAACTGGTTCAGCAC
JH798167:11207135-11207149
GGCACTACTGCAGCAATATGGGAAGATGCC11207135TTCATTGACAACATTGATGAGGAATACGATCAACTGGTTCAGCGC
JH798198:6466443-6466457
GGCACTATTTCGGCAACGTGGGAAGATGCC6466443TTCATTGACAACATTGACCAGGAATACGATTGACTGGTTCAGCAC
JH798199:12564045-12564059
TTTTATGACTGTATTTTCACTAATCACTAT12564045TTCATTGACAACATTATGTTTGTTTTTTGGGCCATGCTCAGAAAT
JH798200:4938768-4938782
AACCTTACAATACATACAACTGCTAACTTT4938768TTCATTGACAACATTTTGGAAGGAAAAACACGTGGTAACTGATTA
JH798201:13085702-13085716
CTTTTTTGAATGGATAAAACAAATGACCTA13085702TTCATTGACAACATTTTGCCCAACAGGATGTCACAAGATCAGGAT
JH798232:744778-744792
GGAACTATTGCGGCAATGTGGGAAGATGCC744778TTCATTGACAACATTGACGAGGAATATGATCTACTGGTTCAGCAC
JH798233:45170-45184
GGTACTACTGCAGCAATATGGGAAGATGCC45170TTCATTGACAACATTGATGAGGAATACGATAGACTGTTTCAGCCC
JH798148:3058404-3058418
ATCACTCTGAAGAGAGTTTGCAGCAAGTTA3058404AATGTTGTCAATGAAGTTTCAGGGGCTCCAAGCTTTTCAGTGTAT
JH798156:23453156-23453170
AAACATTCTATCGATGGGGCATGTGCTCTG23453156AATGTTGTCAATGAACCTAGTGGGAGTCTTGTTTCTGTCCTGTTA
JH798164:9154339-9154353
GGTGATGAACCAGTTGTTGTATTCCTCATC9154339AATGTTGTCAATGAAGGCATCTTCCCACGTTGCCACAATAGTGCC
JH798165:3837226-3837240
GTGCTGAACCAGTTGATTGTATTCCTCGTC3837226AATGTTGTCAATGAAGACATCTTCCCATGTTGCCACAATAGTGCC
JH798165:14440772-14440786
TTAATATTAATATTAAATGGATACCCACAG14440772AATGTTGTCAATGAAAATCTGTGTTGAAGTGATAATGTATTCTAG
JH798166:16503089-16503103
AACATCCTTCTTTTCACCTGGGGTGACATT16503089AATGTTGTCAATGAAATCAAATGTAGTTTCAACCTATCATGCTTT
JH798169:21407599-21407613
GGGCTGAACCAGTCAATCATATTCCTCATC21407599AATGTTGTCAATGAAGGCATCTTCCCACGTTGCTGCAATAGTGAT
JH798176:23456487-23456501
GTGCTGAACCAGTCGATCGTATTCCTCATC23456487AATGTTGTCAATGAAGGCATCTTCCCATATTGCCAAAGAGCTCCC
JH798186:7739191-7739205
GTGCTAAACCAGTTGATCATATTTCTTGTC7739191AATGTTGTCAATGAAGACGTCTTCCCACGCTGCGGCACTAGTGCC
JH798190:7789266-7789280
ATCAATTTGACGTGCAGAACCGAAGCTTTA7789266AATGTTGTCAATGAAATTACATCCCTGTAACTGTCCTGTTGAAAG
JH798214:7846413-7846427
GTGCTGAACCAGTCCATCACATTCCTCATC7846413AATGTTGTCAATGAAGGATTCACATATTTCTGCAGTCAGACCAAA
JH798236:2040381-2040395
TGTAACGTGAAGTATATAAATCAACTTTGG2040381AATGTTGTCAATGAACATAGATATAGTTGGTTGGTCATGATAAAT
JH798255:4700800-4700814
GTGTTGAACCAGTTGATCGTATTCCACATC4700800AATGTTGTCAATGAAGGCATCTTCCCATATTGCTGCAATAGTGCC
JH798280:1671565-1671579
GTCCAGAAAAAAGTGCTACCACGGAAAAAT1671565AATGTTGTCAATGAAGGTCTGGAAACACTGGCCTTAAGGAAGGGC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/sorAra2/TTCATTGACAACATT
lang : en | db : sorAra2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.77:28059/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.006 | search_minus_done; http://172.18.8.77:28059/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=41
0.087 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).