GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-01-18 19:11:13, GGGenome : Pig genome, SGSC Sscrofa10.2/susScr3 (Aug, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2:112682291-112682305
CATGATAACGATCTGAGTCATATAGTTGAG112682291TTCATTGACAACATTTAAATAATCCATAGCTCGTTTCCACTGCTC
chr3:111645292-111645306
TCATGGAAATTATCTTTTCAAGTGATCAGA111645292TTCATTGACAACATTCACTTTGGAAGCCCATACCTCTCCCTTTCC
chr3:111718254-111718268
TCATGGAAATTATCTTTTCAAGTGATCAGA111718254TTCATTGACAACATTCACTTTGGAAGCCCATACCTCTCCCTTTCC
chr3:134971732-134971746
TCTCATTATGTTTTCTTGTACATTCTCAAG134971732TTCATTGACAACATTTGTAATAGCTATTTTAAGGTTCCCATCTAC
chr8:65211461-65211475
ACTTCCTGTCTGGATAGCTCCTTCTCTGGA65211461TTCATTGACAACATTTCCTTTTTTTGTTCACTAACCTTTCCACCA
chr10:1509165-1509179
ATCAGGAGAATTATTGAAGCCATAATGCTT1509165TTCATTGACAACATTTTCTAGATGTTCAGTCTAAAATATATCCTA
chr15:110540171-110540185
GGTCTTACATCTTTAAACTTTCCCTTTCGA110540171TTCATTGACAACATTCAGAAGTCAAAAAATAAACATTGCTTATCA
chr6:131243673-131243687
ATTGTGAGAGCCCAGCAGAACAGAATCTGG131243673AATGTTGTCAATGAAACAGACCTACGTAGTAGTGCTTTACCTAAT
chr7:71906368-71906382
GGATAAGACCAAGCAGTATTACACTTCAAA71906368AATGTTGTCAATGAAACCATTAGCAAGTTTGTTGGAATATTCTTT
chr8:84909693-84909707
TTAATATTAATATTAAATGGATGCCCAGGG84909693AATGTTGTCAATGAAAATCTGTGTTTAAGAGATAATATATTCTAG
chr9:102829075-102829089
TAGGATATATTTTAGACTGAACATCTAGAA102829075AATGTTGTCAATGAAAAGCATTATGGCTTCAATAATTCTCCTGAT
chr11:29443139-29443153
GAAACAGAAACAATGAATAATTGGTTATGA29443139AATGTTGTCAATGAAAAGTACCTGTGATCACAGGCACAGGAAAAA
GL895285-2:61933-61947
GGATAAGACCAAGCAGTATTACACTTCAAA61933AATGTTGTCAATGAAACCATTAGCAAGTTTGTTGGAATATTCTTT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/susScr3/TTCATTGACAACATT
lang : en | db : susScr3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.093 | 0.086 | search_plus_done; http://172.18.8.77:28050/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.098 | 0.005 | search_minus_done; http://172.18.8.77:28050/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.099 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).