GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:45:18, GGGenome : TogoGenome from RefSeq 200 (May, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Mus caroli chromosome 14, CAROLI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10089", bioproject:"PRJNA387030", refseq:"NC_034583.1"
NC_034583.1:98974699-98974713
TGCTGCTGCAGTCACTCCCTGGAGGTTGTG98974699TTCATTGACAACATTGCCCAAGGTGCCTTCCACTGAGAGTGACAA
Mus caroli chromosome 18, CAROLI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10089", bioproject:"PRJNA387030", refseq:"NC_034587.1"
NC_034587.1:568199-568213
TTCCTCAAACTCTAAAAAGTCTTTAATTTC568199TTCATTGACAACATTTTCATTGAGGAGAGTGTTGTTCAGCTTCCA
Mus musculus strain C57BL/6J chromosome 2, GRCm38.p6 C57BL/6J.
taxonomy:"10090", bioproject:"PRJNA169", refseq:"NC_000068.7"
NC_000068.7:131480113-131480127
AGACAAATTAAGACTGTATTGTATCATGGT131480113TTCATTGACAACATTTAAAATTGTTACATATTTCAAAATTTTTTA
Mus musculus strain C57BL/6J chromosome 5, GRCm38.p6 C57BL/6J.
taxonomy:"10090", bioproject:"PRJNA169", refseq:"NC_000071.6"
NC_000071.6:42318229-42318243
TAGAATCAGTGTAAGCCATCCCTACACTTA42318229TTCATTGACAACATTCATGCAATCTTCAGTGTTCATTACTTTGCT
Mus musculus strain C57BL/6J chromosome 6, GRCm38.p6 C57BL/6J.
taxonomy:"10090", bioproject:"PRJNA169", refseq:"NC_000072.6"
NC_000072.6:141421528-141421542
AAAGTACTATCAGTTTCCTAAATATATCCA141421528TTCATTGACAACATTGTTCACTCTTCCATAAACATCTGCTGGTTA
Mus musculus strain C57BL/6J chromosome 6, GRCm38.p6 C57BL/6J.
taxonomy:"10090", bioproject:"PRJNA169", refseq:"NC_000072.6"
NC_000072.6:146175076-146175090
TGAACACATTCTCCCTGTTTGTGTCATCAC146175076TTCATTGACAACATTTAACTGGGCCTTCTGTGTGGATACCATGAT
Mus musculus strain C57BL/6J chromosome 10, GRCm38.p6 C57BL/6J.
taxonomy:"10090", bioproject:"PRJNA169", refseq:"NC_000076.6"
NC_000076.6:47062898-47062912
TATTTCTTTCTGTTTGTTTATATGATGGAC47062898TTCATTGACAACATTTCATATATGTAACCATCCTGTATCTCTGTA
Mus musculus strain C57BL/6J chromosome 14, GRCm38.p6 C57BL/6J.
taxonomy:"10090", bioproject:"PRJNA169", refseq:"NC_000080.6"
NC_000080.6:109241664-109241678
TGCTGCTGGAATCTCTCCCTGGAGGGTGTG109241664TTCATTGACAACATTGCCCACTGAGAGTGACAACCTCAGCAGCCA
Mus pahari chromosome 2, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034591.1"
NC_034591.1:156183567-156183581
AGAGTACTATTAGTTTCCTAAATATACCCA156183567TTCATTGACAACATTGTTCACTCTTCCATAAGCACCTGCTGTTAT
Mus pahari chromosome 2, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034591.1"
NC_034591.1:160645130-160645144
CGAACACACTCTCCCTGTTCGTGTCATCAC160645130TTCATTGACAACATTTAACCAGGCCTTCTCTGTGGCCTCATGATA
Mus pahari chromosome 4, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034593.1"
NC_034593.1:137821595-137821609
TCTTTATTTGTTGACATTTCTATTTTGTCT137821595TTCATTGACAACATTGCAATCAAATATTCATTCCTTCACTCAATG
Mus pahari chromosome 10, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034599.1"
NC_034599.1:34125822-34125836
CTACATCCCAACATTAATATCTTATTTGAA34125822TTCATTGACAACATTTATAATTTCTGTTTCAAGTTGTCATTTACA
Mus pahari chromosome 14, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034603.1"
NC_034603.1:8720060-8720074
TAGGAAAAACAAAGGGATTGGGTGCACACC8720060TTCATTGACAACATTCACTGCCTTCAGGTGGACTTTCTGTACATG
Mus pahari chromosome 16, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034605.1"
NC_034605.1:8915162-8915176
CTGGGGAGGTAGAGATGGAAAAATCAGAAG8915162TTCATTGACAACATTGGTTATATTGTAAGTTCAAAGCCAGCCTGA
Mus pahari chromosome 17, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034606.1"
NC_034606.1:35452727-35452741
AAATGTTTCTATGTAAAAGTTAGTCTTATT35452727TTCATTGACAACATTGATGTCTAAATTTCACATGTCTCCTTATAT
Mus pahari chromosome 19, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034608.1"
NC_034608.1:38918721-38918735
ACTGAAACTGAAAAAAGAAAGAAGGGAGTT38918721TTCATTGACAACATTTCTTCTCATTTTTAGCTTCTGAAATGGGGG
Mus pahari chromosome 22, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034611.1"
NC_034611.1:21581612-21581626
GCAAACCTCTTAATATCCTTGAATTTTTGA21581612TTCATTGACAACATTTTTGGTTTTAACTGGGTGACTCTTGATGAT
Sphingobacterium mizutaii strain NCTC12149 chromosome 1.
taxonomy:"1010", bioproject:"PRJNA224116", refseq:"NZ_LT906468.1"
NZ_LT906468.1:3037476-3037490
ATAGCCTCTTGGCAAGGTTTTCAATGCCAC3037476TTCATTGACAACATTGATCGCTTCACCTGAACTATAGCCTTGTTT
Fragaria vesca subsp. vesca linkage group LG6, FraVesHawaii_1.0, whole genome shotgun sequence.
taxonomy:"101020", bioproject:"PRJNA66853", refseq:"NC_020496.1"
NC_020496.1:7676434-7676448
GTCGTCTTACTTGGGACAGCCGCTTCCATT7676434TTCATTGACAACATTGATCTGGATCGAGGTTCTGGTGATCGGCTA
Rattus norvegicus strain mixed chromosome 2, Rnor_6.0.
taxonomy:"10116", bioproject:"PRJNA12455", refseq:"NC_005101.4"
NC_005101.4:41926733-41926747
TTTTCAAAATCTTTTGCCTGTATAGACTTT41926733TTCATTGACAACATTAAACTGTATGACATGCAAAAAATAACAGGT
Rattus norvegicus strain mixed chromosome 2, Rnor_6.0.
taxonomy:"10116", bioproject:"PRJNA12455", refseq:"NC_005101.4"
NC_005101.4:57234252-57234266
CCTCTCCCATTTACATTTAGTTTTAAGTAA57234252TTCATTGACAACATTTTTTGCATTGTTCAGCCCTTTACCTGTATT
Rattus norvegicus strain mixed chromosome 2, Rnor_6.0.
taxonomy:"10116", bioproject:"PRJNA12455", refseq:"NC_005101.4"
NC_005101.4:60329867-60329881
CTGAACTTTCACCATAACAACCCATTAGGT60329867TTCATTGACAACATTCTATGGCAGCTATAGACCCCAACTCCAAAT
Rattus norvegicus strain mixed chromosome 2, Rnor_6.0.
taxonomy:"10116", bioproject:"PRJNA12455", refseq:"NC_005101.4"
NC_005101.4:91373041-91373055
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT91373041TTCATTGACAACATTAAATATTTACTGAATCTTAAATCTTATCCT
Rattus norvegicus strain mixed chromosome 4, Rnor_6.0.
taxonomy:"10116", bioproject:"PRJNA12455", refseq:"NC_005103.4"
NC_005103.4:160096536-160096550
AAACTGCGCTAAGCAAGACGGTATGGTATT160096536TTCATTGACAACATTAAAGAAAATAGAGAGATAGACACTCGTGTG
Rattus norvegicus strain mixed chromosome 14, Rnor_6.0.
taxonomy:"10116", bioproject:"PRJNA12455", refseq:"NC_005113.4"
NC_005113.4:32365434-32365448
GAAGCTAATAGTGCAATCGCCATGGTCTCC32365434TTCATTGACAACATTAACAGCTGTAATAAAATCAAGATATTGGCA
Rattus norvegicus strain mixed chromosome 18, Rnor_6.0.
taxonomy:"10116", bioproject:"PRJNA12455", refseq:"NC_005117.4"
NC_005117.4:24697076-24697090
ACATTCCTTACTCCTCTGACAGCAGTTTCT24697076TTCATTGACAACATTCAGGCTATCAGGCCTGATGTTGAGGTCCTT
Rattus rattus isolate New Zealand chromosome 1, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046154.1"
NC_046154.1:73019131-73019145
TTTTTCAGATTATTTGATGAACAGATCTAT73019131TTCATTGACAACATTAAAGTTTCAAATGTATAATTGTTGACAATG
Rattus rattus isolate New Zealand chromosome 1, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046154.1"
NC_046154.1:197289849-197289863
ATGAACAGATACCATGACCAAAGCAACAAT197289849TTCATTGACAACATTTAATTGGGGCTGGCTTACAGGTTCAGAGAG
Rattus rattus isolate New Zealand chromosome 1, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046154.1"
NC_046154.1:246612330-246612344
ACTTCTCGCCTTTTACCATCCCTTATATCT246612330TTCATTGACAACATTGGACTGGTGGTCAGGCTTAGCCTTTGGGGT
Rattus rattus isolate New Zealand chromosome 3, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046156.1"
NC_046156.1:221577579-221577593
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT221577579TTCATTGACAACATTAAATATTTACTGAATCTTAAATCTTATCCT
Rattus rattus isolate New Zealand chromosome 4, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046157.1"
NC_046157.1:8207259-8207273
TTTTTAACCTTCTTTTCTTATTGTTAAATT8207259TTCATTGACAACATTTTCCTTTTGGTGTAATTTTAAAAAGAATAA
Rattus rattus isolate New Zealand chromosome 6, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046159.1"
NC_046159.1:83566318-83566332
GCTTTCCAGTAGGTGACAACACATGTGCAT83566318TTCATTGACAACATTGATTTCCTTCCTTGTATCCGCTACACATAC
Rattus rattus isolate New Zealand chromosome 6, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046159.1"
NC_046159.1:142412968-142412982
CAGAAATATCCACAGATTTATATTGTCCAT142412968TTCATTGACAACATTTTGGTGGTATCTCCAGATGAAAAGGAATTG
Prunus mume isolate 4 linkage group LG6, P.mume_V1.0, whole genome shotgun sequence.
taxonomy:"102107", bioproject:"PRJNA246160", refseq:"NC_024131.1"
NC_024131.1:5831687-5831701
TCCTATTTTGATACAATAATAACTAGGCAA5831687TTCATTGACAACATTTTAGTGAAACATGTGAACAACAAGAGGAAA
Prunus mume isolate 4 linkage group LG8, P.mume_V1.0, whole genome shotgun sequence.
taxonomy:"102107", bioproject:"PRJNA246160", refseq:"NC_024133.1"
NC_024133.1:8675412-8675426
AACAAACAATTTTAGTACGTGAAACCTTAA8675412TTCATTGACAACATTCTACAGGAATTTATTAATCTATCTTTCGAG
Nothobranchius furzeri strain GRZ chromosome sgr02, Nfu_20140520, whole genome shotgun sequence.
taxonomy:"105023", bioproject:"PRJNA314891", refseq:"NC_029650.1"
NC_029650.1:11877290-11877304
TTATGCATAAGCAGCAACATAAGCAGTTAT11877290TTCATTGACAACATTTTCTTGTGGAGTGGCAGTGGACTAAGAAAG
Nothobranchius furzeri strain GRZ chromosome sgr03, Nfu_20140520, whole genome shotgun sequence.
taxonomy:"105023", bioproject:"PRJNA314891", refseq:"NC_029651.1"
NC_029651.1:56682950-56682964
TATTTTGGAGAAATATAATCCAGACATTAT56682950TTCATTGACAACATTCACTATCACACATCATAGCCCCATCACACA
Nothobranchius furzeri strain GRZ chromosome sgr12, Nfu_20140520, whole genome shotgun sequence.
taxonomy:"105023", bioproject:"PRJNA314891", refseq:"NC_029660.1"
NC_029660.1:35843992-35844006
GTTTTCCAGCGCTTCCAAAGAATAAAGGAC35843992TTCATTGACAACATTTAAAATATTTGATGATCCCTCATTGGAACG
Maylandia zebra isolate #2_Kocher and #3_Kocher ecotype Mazinzi reef linkage group LG1, M_zebra_UMD2a, whole genome shotgun sequence.
taxonomy:"106582", bioproject:"PRJNA198780", refseq:"NC_036780.1"
NC_036780.1:7430766-7430780
AGAGCTGCTTTAACCGATTAGAAGCAATTA7430766TTCATTGACAACATTCAAGTAATGCTCAGGTGATAAAAGTAAGCA
Maylandia zebra isolate #2_Kocher and #3_Kocher ecotype Mazinzi reef linkage group LG3, M_zebra_UMD2a, whole genome shotgun sequence.
taxonomy:"106582", bioproject:"PRJNA198780", refseq:"NC_036782.1"
NC_036782.1:16697971-16697985
TAATAGTGTTAAAGATTTTTAAAGGCATCC16697971TTCATTGACAACATTGTGTCTCTTTGACTTCACACAATGAATAAC
Maylandia zebra isolate #2_Kocher and #3_Kocher ecotype Mazinzi reef linkage group LG16, M_zebra_UMD2a, whole genome shotgun sequence.
taxonomy:"106582", bioproject:"PRJNA198780", refseq:"NC_036795.1"
NC_036795.1:1698880-1698894
GCCCAACAGGCCCACAGAACCACCAACTTT1698880TTCATTGACAACATTTTGAGACCGGACTTTGGCTGCAAGAAGGAG
Brassica oleracea var. oleracea cultivar TO1000 chromosome C2, BOL, whole genome shotgun sequence.
taxonomy:"109376", bioproject:"PRJNA293438", refseq:"NC_027749.1"
NC_027749.1:1833539-1833553
CGTGATGCCGAGGGCCAAGATGTGTTGCTT1833539TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCTATGTTGTT
Brassica oleracea var. oleracea cultivar TO1000 chromosome C9, BOL, whole genome shotgun sequence.
taxonomy:"109376", bioproject:"PRJNA293438", refseq:"NC_027756.1"
NC_027756.1:51450097-51450111
CGTGATGCTGAAGGCCAAGATGTGTTGCTT51450097TTCATTGACAACATTTTCCGTTTCACTCAGGTGAACTTCTATGTT
Brassica oleracea var. oleracea cultivar TO1000 chromosome C9, BOL, whole genome shotgun sequence.
taxonomy:"109376", bioproject:"PRJNA293438", refseq:"NC_027756.1"
NC_027756.1:51455784-51455798
CGTGATGCTGAAGGCCAAGATGTGTTGCTT51455784TTCATTGACAACATTTTCCGTTTCACTCAGGTGAACTTCTATGTT
Scleropages formosus chromosome 13, fSclFor1.1, whole genome shotgun sequence.
taxonomy:"113540", bioproject:"PRJNA540586", refseq:"NC_041818.1"
NC_041818.1:8153374-8153388
TTCTTTACAGTAAGCTGAGAAAATGATCAC8153374TTCATTGACAACATTGGACCTACTATTAAACTACTTTTGTAACAC
Candida orthopsilosis Co 90-125, chromosome 4 draft sequence.
taxonomy:"1136231", bioproject:"PRJNA172186", refseq:"NC_018297.1"
NC_018297.1:1267948-1267962
TAGCTACTTTGATCCAACAACTAAACACTC1267948TTCATTGACAACATTGTCTTGCTTGGAGCTTATTGAGATGTAGGT
Candida orthopsilosis Co 90-125, chromosome 5 draft sequence.
taxonomy:"1136231", bioproject:"PRJNA172186", refseq:"NC_018298.1"
NC_018298.1:489580-489594
AGAGATGAAGAAGGTCAAGATGTCTTGTTG489580TTCATTGACAACATTTTCAGATTCACCCAAGCTGGTTCGGAAGTG
Belonocnema treatae isolate 2016_QV_RU_SX_M_011 chromosome 1, B_treatae_v1, whole genome shotgun sequence.
taxonomy:"1159321", bioproject:"PRJNA623416", refseq:"NC_046657.1"
NC_046657.1:276792-276806
TTTGTGGTCGCCAACTCAATATTTGTAGGG276792TTCATTGACAACATTCTTTAATAAAAATTACTGTATTATAACTTA
Belonocnema treatae isolate 2016_QV_RU_SX_M_011 chromosome 1, B_treatae_v1, whole genome shotgun sequence.
taxonomy:"1159321", bioproject:"PRJNA623416", refseq:"NC_046657.1"
NC_046657.1:75107844-75107858
TTATCATTCTTCTTCCTGGTCGTTTCCCCT75107844TTCATTGACAACATTCGCTCTAGCCTTTCTTCCTCCATACCAGTC
Belonocnema treatae isolate 2016_QV_RU_SX_M_011 chromosome 4, B_treatae_v1, whole genome shotgun sequence.
taxonomy:"1159321", bioproject:"PRJNA623416", refseq:"NC_046660.1"
NC_046660.1:12238950-12238964
TTTTCAACCAAAAATTATGTATTTCAATTT12238950TTCATTGACAACATTAATTTTCAATGAAAAAACGAATTTTTAACA
Olea europaea var. sylvestris chromosome 16, O_europaea_v1, whole genome shotgun sequence.
taxonomy:"158386", bioproject:"PRJNA417827", refseq:"NC_036252.1"
NC_036252.1:8931381-8931395
CATCAGTATTTAGATCAATTTTTCATAGTC8931381TTCATTGACAACATTTTGATATATTCTAACAGTAAAGATCAACAT
Olea europaea var. sylvestris chromosome 16, O_europaea_v1, whole genome shotgun sequence.
taxonomy:"158386", bioproject:"PRJNA417827", refseq:"NC_036252.1"
NC_036252.1:15781118-15781132
GTCCAGAATTCATTCATGAATTTGGTTTTC15781118TTCATTGACAACATTAGCAATATCAGGGTCACGAGTTTGTTTAGT
Olea europaea var. sylvestris chromosome 16, O_europaea_v1, whole genome shotgun sequence.
taxonomy:"158386", bioproject:"PRJNA417827", refseq:"NC_036252.1"
NC_036252.1:17801594-17801608
CATTAGTATTTGGATAAATTTGTCATAGTC17801594TTCATTGACAACATTTTGATATACTCCAAAAGTAAAGATTAACAT
Olea europaea var. sylvestris chromosome 18, O_europaea_v1, whole genome shotgun sequence.
taxonomy:"158386", bioproject:"PRJNA417827", refseq:"NC_036254.1"
NC_036254.1:27977631-27977645
TTGAGAAATTATAACCCACAATAAATTGCT27977631TTCATTGACAACATTTGTTAATTTTAGCTCACATCAAATTGTTTT
Megamonas hypermegale strain NCTC10570 chromosome 1.
taxonomy:"158847", bioproject:"PRJNA224116", refseq:"NZ_LT906446.1"
NZ_LT906446.1:1902571-1902585
ATTTTATGGCTTAGCGCTATTGCTTCTGCT1902571TTCATTGACAACATTCCATTCGTTGCCACTTTAATCCCAATGATA
Echeneis naucrates chromosome 5, fEcheNa1.1, whole genome shotgun sequence.
taxonomy:"173247", bioproject:"PRJNA548465", refseq:"NC_042515.1"
NC_042515.1:10468187-10468201
TGGTTGGGTTTTTATGGACCCAGTGGATAT10468187TTCATTGACAACATTCATCTGACGAGGATCACTGTGAGGGTTCCA
Echeneis naucrates chromosome 7, fEcheNa1.1, whole genome shotgun sequence.
taxonomy:"173247", bioproject:"PRJNA548465", refseq:"NC_042517.1"
NC_042517.1:19567920-19567934
TGTAACCCCAACCTTCAGGTTTTCAATGTG19567920TTCATTGACAACATTGATGAGAGACTCCCGAGAATTGCTTTATTT
Echeneis naucrates chromosome 9, fEcheNa1.1, whole genome shotgun sequence.
taxonomy:"173247", bioproject:"PRJNA548465", refseq:"NC_042519.1"
NC_042519.1:10905262-10905276
TGCCAAAGAAAATCCGAACTAAGGTTTACT10905262TTCATTGACAACATTTGGCTTTGACATTTGTGAAAAATCTTGTTG
Echeneis naucrates chromosome 13, fEcheNa1.1, whole genome shotgun sequence.
taxonomy:"173247", bioproject:"PRJNA548465", refseq:"NC_042523.1"
NC_042523.1:14961080-14961094
GAAAGTCTTTTAAAAGGGTTCACTGACTTT14961080TTCATTGACAACATTTCAAAACTGTGACAGGAGAAAAAAACCCAA
Arcticibacterium luteifluviistationis strain SM1504T chromosome, complete genome.
taxonomy:"1784714", bioproject:"PRJNA224116", refseq:"NZ_CP029480.1"
NZ_CP029480.1:1286209-1286223
GGAGGAAAAGGCTCTAAGGCTTCTTGGTTT1286209TTCATTGACAACATTTTTGAAGAGCTAGATGTGGCCCGTGAGTGG
Anopheles gambiae str. PEST chromosome 2L, whole genome shotgun sequence.
taxonomy:"180454", bioproject:"PRJNA163", refseq:"NT_078265.2"
NT_078265.2:30115449-30115463
ACGATTACTTATTTGTCTTAAATTGAAGCA30115449TTCATTGACAACATTTAAAGAAAATACTTTTTGTTGTTACTATTT
Anopheles gambiae str. PEST chromosome 3R, whole genome shotgun sequence.
taxonomy:"180454", bioproject:"PRJNA163", refseq:"NT_078268.4"
NT_078268.4:45062609-45062623
TCCTCCTTCGCTCTCACACACACACACACC45062609TTCATTGACAACATTGGAAACTACACACATTGAGGAAATTTAAAT
Salarias fasciatus chromosome 3, fSalaFa1.1, whole genome shotgun sequence.
taxonomy:"181472", bioproject:"PRJNA555318", refseq:"NC_043747.1"
NC_043747.1:14188572-14188586
TTAAAAGTGATTTTTCTCACTAATTCCCTT14188572TTCATTGACAACATTTTTGCTAAGTTCTTTGCACTGCGACCTTTT
Salarias fasciatus chromosome 20, fSalaFa1.1, whole genome shotgun sequence.
taxonomy:"181472", bioproject:"PRJNA555318", refseq:"NC_043764.1"
NC_043764.1:14451266-14451280
TAACGTCAGCAGATACTCATTTAATCCATG14451266TTCATTGACAACATTTCATCTTGGTTCAACTTCCTCACTGCTGCC
Salarias fasciatus chromosome 23, fSalaFa1.1, whole genome shotgun sequence.
taxonomy:"181472", bioproject:"PRJNA555318", refseq:"NC_043766.1"
NC_043766.1:10694098-10694112
ATGATTAAACATCGCCAACAAATCAGAAAA10694098TTCATTGACAACATTGTGTAACAATAGAAGACAATCACAAACGCA
Gopherus evgoodei ecotype Sinaloan lineage chromosome 1, rGopEvg1_v1.p, whole genome shotgun sequence.
taxonomy:"1825980", bioproject:"PRJNA559383", refseq:"NC_044322.1"
NC_044322.1:345347028-345347042
ACCCTGAGGAACATCAATGTCCACAAGGAA345347028TTCATTGACAACATTTATATGGAGATGTCCAAGGATGAGGAAGCT
Gopherus evgoodei ecotype Sinaloan lineage chromosome 3, rGopEvg1_v1.p, whole genome shotgun sequence.
taxonomy:"1825980", bioproject:"PRJNA559383", refseq:"NC_044324.1"
NC_044324.1:136172966-136172980
CTGTTAACATTGAAGCATAACGATGACAAT136172966TTCATTGACAACATTGTTAACTCTTGTTAAAATGGCAGATTATGC
Gopherus evgoodei ecotype Sinaloan lineage chromosome 7, rGopEvg1_v1.p, whole genome shotgun sequence.
taxonomy:"1825980", bioproject:"PRJNA559383", refseq:"NC_044328.1"
NC_044328.1:113643173-113643187
TAATAGAAAGTCTTCCTAATTACATATTCC113643173TTCATTGACAACATTGTCTCCATCCATGAAAGATGGATGAGAGTT
Gopherus evgoodei ecotype Sinaloan lineage chromosome 8, rGopEvg1_v1.p, whole genome shotgun sequence.
taxonomy:"1825980", bioproject:"PRJNA559383", refseq:"NC_044329.1"
NC_044329.1:87138609-87138623
TGGACTAGAGCTGGCTGGAGGAAAATGCAA87138609TTCATTGACAACATTTGAGATTTTGAAATTTATTTATGAAAACAA
Gopherus evgoodei ecotype Sinaloan lineage chromosome 16, rGopEvg1_v1.p, whole genome shotgun sequence.
taxonomy:"1825980", bioproject:"PRJNA559383", refseq:"NC_044337.1"
NC_044337.1:1987362-1987376
TGGGGTATTTTGTGAATAGTGAGTTTTCCC1987362TTCATTGACAACATTTTCATTTTGGGAGAGAAGTTCTGACCAGAT
Macrococcus canis strain KM 45013 chromosome, complete genome.
taxonomy:"1855823", bioproject:"PRJNA224116", refseq:"NZ_CP021059.1"
NZ_CP021059.1:1487214-1487228
AACCCACTCGACATCGATCAATCGCTCGGT1487214TTCATTGACAACATTAGGACATTCCGTTCGATGCACCTTGACACC
Synechococcus lividus PCC 6715 chromosome, complete genome.
taxonomy:"1917166", bioproject:"PRJNA224116", refseq:"NZ_CP018092.1"
NZ_CP018092.1:605902-605916
TTCAACCTTGACCCACCACGCTAAACCAAT605902TTCATTGACAACATTGGCCAGCCAGCCAGTAAAGGTTGTGTTATT
Rhinatrema bivittatum chromosome 1, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042615.1"
NC_042615.1:77667568-77667582
CTATATAAAGGATTCCACAGATTTTATTAA77667568TTCATTGACAACATTACAGTATATAGAATCGGATTGGCTATTGGT
Rhinatrema bivittatum chromosome 1, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042615.1"
NC_042615.1:291790719-291790733
TTAATTCATTATTGTAAGATCCAACTGTTT291790719TTCATTGACAACATTTGGTCTTTCCATAACAATCCAATGTTTGCC
Rhinatrema bivittatum chromosome 1, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042615.1"
NC_042615.1:685255842-685255856
GTGGCATCAGTAGGCTACCTGAGATCAGCG685255842TTCATTGACAACATTTACAAAGCTGTGAAATGGCATTCTCTCCAC
Rhinatrema bivittatum chromosome 4, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042618.1"
NC_042618.1:126973452-126973466
TACAAAAAGAATATCCTAGTGTGGCGCCGT126973452TTCATTGACAACATTTTCATTGTGTGGCATGGGACTGAGGTCCTT
Rhinatrema bivittatum chromosome 5, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042619.1"
NC_042619.1:83107814-83107828
GTGGTAGAGTATAAATACGATCTAATGTTT83107814TTCATTGACAACATTTGGTCAAGGTATCTATCATTTGATTGACAG
Rhinatrema bivittatum chromosome 6, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042620.1"
NC_042620.1:211000394-211000408
TGGTGGGCAGACATCAAATGCTGGCTTCAT211000394TTCATTGACAACATTTTCTTCATTTGGATAGGTTCAGATCAACAA
Rhinatrema bivittatum chromosome 6, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042620.1"
NC_042620.1:346678529-346678543
CAGTTTCAACATATTGTATTTTGGATGAGA346678529TTCATTGACAACATTTTTTTTTTTTATTTGGAAGTCTGATTTTTC
Rhinatrema bivittatum chromosome 7, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042621.1"
NC_042621.1:39631119-39631133
TCTTCATTCAACATTTCCCGCTGCGTTTTC39631119TTCATTGACAACATTGACTGTACACCCATCGGGGTTAAACAAAGA
Rhinatrema bivittatum chromosome 7, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042621.1"
NC_042621.1:194531118-194531132
ATGTAAAGGTCAGCGAAGGGTTGCAAATCT194531118TTCATTGACAACATTTTGAGCTATATTTAAGGACAGCTTTTGCAC
Enterococcus wangshanyuanii strain MN05 chromosome, complete genome.
taxonomy:"2005703", bioproject:"PRJNA224116", refseq:"NZ_CP021874.1"
NZ_CP021874.1:973862-973876
GACAACATTTGTCGTTGAATCCGTTTGAAC973862TTCATTGACAACATTTTTTTCACTTTGCTCTTCTACCTTAGGTTC
Ooceraea biroi isolate clonal line C1 chromosome 5, Obir_v5.4, whole genome shotgun sequence.
taxonomy:"2015173", bioproject:"PRJNA501908", refseq:"NC_039510.1"
NC_039510.1:7152685-7152699
ACTATTCCAACCGACAGTAAAGATATCACG7152685TTCATTGACAACATTCTTAAGCTTATTACATTCTTATCATAAAAC
Bacillus paranthracis strain PR1 chromosome, complete genome.
taxonomy:"2026186", bioproject:"PRJNA224116", refseq:"NZ_CP040515.1"
NZ_CP040515.1:3720525-3720539
ATAGGAACTGTTCCGGCTAACAATACGGTG3720525TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
Bacillus luti strain FJ chromosome, complete genome.
taxonomy:"2026191", bioproject:"PRJNA224116", refseq:"NZ_CP040336.1"
NZ_CP040336.1:3569966-3569980
ATCGGAACCGTTCCAGCTAACAATACAGTG3569966TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
Mastacembelus armatus chromosome 3, fMasArm1.2, whole genome shotgun sequence.
taxonomy:"205130", bioproject:"PRJNA489256", refseq:"NC_046635.1"
NC_046635.1:19385403-19385417
GCTACTGGAAAATTCTGGAGATACCTGACT19385403TTCATTGACAACATTAAGACAATATTCAATATTCCAGATGTACCT
Panicum hallii strain FIL2 chromosome 4, PHallii_v3.1, whole genome shotgun sequence.
taxonomy:"206008", bioproject:"PRJNA482138", refseq:"NC_038045.1"
NC_038045.1:11852158-11852172
ATGCCGGAATTAGACAAATTTGTCGTGGTC11852158TTCATTGACAACATTCTAATATACTCTAAAACTAAAGAAGACCAT
Panicum hallii strain FIL2 chromosome 6, PHallii_v3.1, whole genome shotgun sequence.
taxonomy:"206008", bioproject:"PRJNA482138", refseq:"NC_038047.1"
NC_038047.1:11099902-11099916
ATGCCAGAACTCGATAAATTCGTCGTGGTC11099902TTCATTGACAACATTCTAATATACTCCAAAACTAAAGAAGACCAT
Nymphaea colorata isolate Beijing-Zhang1983 chromosome 2, ASM883128v1, whole genome shotgun sequence.
taxonomy:"210225", bioproject:"PRJNA587754", refseq:"NC_045139.1"
NC_045139.1:4995397-4995411
CGAGATGCTGAGGGACAAGATGTGCTTCTT4995397TTCATTGACAACATTTTCCGTTTCACTCAAGTAACTATTCCTTTT
Nymphaea colorata isolate Beijing-Zhang1983 chromosome 3, ASM883128v1, whole genome shotgun sequence.
taxonomy:"210225", bioproject:"PRJNA587754", refseq:"NC_045140.1"
NC_045140.1:380557-380571
GTAAAGTAAAGTTTTTATTAATAGGTGTTT380557TTCATTGACAACATTAACTGCTAGGACAGATCGTGCTGTGCACTA
Nymphaea colorata isolate Beijing-Zhang1983 chromosome 8, ASM883128v1, whole genome shotgun sequence.
taxonomy:"210225", bioproject:"PRJNA587754", refseq:"NC_045145.1"
NC_045145.1:9909366-9909380
ATAATCCTATTCTAGGTATGATATTGAAGC9909366TTCATTGACAACATTGACTTCCTTGACTCCATTATACTTACTCAA
Nymphaea colorata isolate Beijing-Zhang1983 chromosome 11, ASM883128v1, whole genome shotgun sequence.
taxonomy:"210225", bioproject:"PRJNA587754", refseq:"NC_045148.1"
NC_045148.1:18151423-18151437
CGTGATGCTGAAGGGCAAGATGTGCTTCTT18151423TTCATTGACAACATTTTCCGTTTTACTCAAGTAAAATTACCTCTT
Parambassis ranga chromosome 9, fParRan2.1, whole genome shotgun sequence.
taxonomy:"210632", bioproject:"PRJNA526690", refseq:"NC_041030.1"
NC_041030.1:17951624-17951638
TTTCACACCACCTGAGAATGTGCCTGGTTG17951624TTCATTGACAACATTACCCGACTTTATTCAATAAACTGTGCCAGC
Mycoplasma bovigenitalium strain NCTC10122 chromosome 1.
taxonomy:"2112", bioproject:"PRJNA224116", refseq:"NZ_LR214970.1"
NZ_LR214970.1:186597-186611
AATATCAAAACATCTTTCTGCTAGTTGTGC186597TTCATTGACAACATTAGCCAAAGATTTTGAAAAAGTAAGAGTTGT
Musa acuminata subsp. malaccensis chromosome 2, ASM31385v2, whole genome shotgun sequence.
taxonomy:"214687", bioproject:"PRJNA262552", refseq:"NC_025203.1"
NC_025203.1:221480-221494
TAACACTTTTACAAGGTATATCCATTTCAG221480TTCATTGACAACATTTCATTACATACAAAATATGCTTATACAACA
Musa acuminata subsp. malaccensis chromosome 3, ASM31385v2, whole genome shotgun sequence.
taxonomy:"214687", bioproject:"PRJNA262552", refseq:"NC_025204.1"
NC_025204.1:24998806-24998820
TGAGTAAAAGTAGTTCCCAGTAACAGTCAT24998806TTCATTGACAACATTGATTCCATAAATTTTGCTTCTTTCTCAGTG
Musa acuminata subsp. malaccensis chromosome 6, ASM31385v2, whole genome shotgun sequence.
taxonomy:"214687", bioproject:"PRJNA262552", refseq:"NC_025207.1"
NC_025207.1:9193103-9193117
GAACTCGTAGCGTATACTAACTACATTGTT9193103TTCATTGACAACATTAGTCCACCAGATCCTTCTTTCAAGACCGCA
Musa acuminata subsp. malaccensis chromosome 10, ASM31385v2, whole genome shotgun sequence.
taxonomy:"214687", bioproject:"PRJNA262552", refseq:"NC_025211.1"
NC_025211.1:12672301-12672315
TAACACTTTTATATGGTATATCCATTTTGA12672301TTCATTGACAACATTTCATAACGTACAAAATATGCTTATACAATA
Entomoplasma luminosum strain PIMN-1 chromosome, complete genome.
taxonomy:"214888", bioproject:"PRJNA224116", refseq:"NZ_CP024963.1"
NZ_CP024963.1:837152-837166
ATTTGGTAATCTAATTAGATTTGTTGTTTT837152TTCATTGACAACATTTGTGACAAATTTTTCCATTGCCTCAACTAA
Larimichthys crocea isolate SSNF chromosome XXI, L_crocea_2.0, whole genome shotgun sequence.
taxonomy:"215358", bioproject:"PRJNA354443", refseq:"NC_040031.1"
NC_040031.1:17425253-17425267
AATGTTCATAGTGCATGTATCAGCAAAATA17425253TTCATTGACAACATTTTCTGTAAAATGGGAATACAATGGCCAGAC
Bos indicus x Bos taurus breed Angus x Brahman F1 hybrid chromosome 7, Bos_hybrid_MaternalHap_v2.0, whole genome shotgun sequence.
taxonomy:"30522", bioproject:"PRJNA508959", refseq:"NC_040082.1"
NC_040082.1:8473641-8473655
CATGATAACAATCTGAGTCATGTAGTTGAG8473641TTCATTGACAACATTTAAATAATCCATAGCTCGTTTCCACTGTTC
Bos indicus x Bos taurus breed Angus x Brahman F1 hybrid chromosome 7, Bos_hybrid_MaternalHap_v2.0, whole genome shotgun sequence.
taxonomy:"30522", bioproject:"PRJNA508959", refseq:"NC_040082.1"
NC_040082.1:46705352-46705366
ATATATGTTTTTAACCAGGGACTCTACACA46705352TTCATTGACAACATTGAAAAATCTCTTTCATTCCCTCCACACATC
Bos indicus x Bos taurus breed Angus x Brahman F1 hybrid chromosome 9, Bos_hybrid_MaternalHap_v2.0, whole genome shotgun sequence.
taxonomy:"30522", bioproject:"PRJNA508959", refseq:"NC_040084.1"
NC_040084.1:13955917-13955931
CCAGAGCTTCTGCTTCTATCCTGAATTAGG13955917TTCATTGACAACATTCCCTTCACCACCCTACTCTTTCTTATACTT
Bos indicus x Bos taurus breed Angus x Brahman F1 hybrid chromosome 19, Bos_hybrid_MaternalHap_v2.0, whole genome shotgun sequence.
taxonomy:"30522", bioproject:"PRJNA508959", refseq:"NC_040094.1"
NC_040094.1:23466143-23466157
CAGTGACTCCCCCTGACTCACTGCTTTAAA23466143TTCATTGACAACATTTTTTAAAAGGTAGAGAATTCTCATGAAAAG
Bos indicus x Bos taurus breed Angus x Brahman F1 hybrid chromosome 24, Bos_hybrid_MaternalHap_v2.0, whole genome shotgun sequence.
taxonomy:"30522", bioproject:"PRJNA508959", refseq:"NC_040099.1"
NC_040099.1:23966357-23966371
TAGAAGTTCTTAATGTTTGTTTTCTTGGCT23966357TTCATTGACAACATTCCTTTTTGTGTGACCTCATCCACTACCAGC
Bos indicus x Bos taurus breed Angus x Brahman F1 hybrid chromosome 24, Bos_hybrid_MaternalHap_v2.0, whole genome shotgun sequence.
taxonomy:"30522", bioproject:"PRJNA508959", refseq:"NC_040099.1"
NC_040099.1:60703203-60703217
ATACTTTCTCATTACAGAAAACAGCAATCG60703203TTCATTGACAACATTAACCTAAAAAAGTTCACCTACAACATTGTC
Microcebus murinus isolate mixed chromosome 1, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033660.1"
NC_033660.1:82124077-82124091
ACTAAATAAATGTTGCATTAAAGAACAAGT82124077TTCATTGACAACATTGCAGTAAAATTGCTTTGCTTCTGACATTTC
Microcebus murinus isolate mixed chromosome 3, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033662.1"
NC_033662.1:35611693-35611707
CAAAATATTTGGTTAAACAAAACCTCCTCT35611693TTCATTGACAACATTGTTTTGATGAAATGGATGAAAAGTTTCCCT
Microcebus murinus isolate mixed chromosome 3, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033662.1"
NC_033662.1:79469337-79469351
ACAAGTTTCTGTTTTGCTCTCTTTTCTGAC79469337TTCATTGACAACATTACTAAATATATTAATAGCATACTGGAAAGC
Microcebus murinus isolate mixed chromosome 4, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033663.1"
NC_033663.1:56276637-56276651
TAACATGTTTAAAAGAACGATTAATTGGCC56276637TTCATTGACAACATTTAAAATTAATTATTTTTACCCAATTAAGGA
Microcebus murinus isolate mixed chromosome 12, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033671.1"
NC_033671.1:78332985-78332999
CATGATAACAATCTGAGTCATGTAGTTGAG78332985TTCATTGACAACATTTAAATAATCCATAGCTCTTTTCCACTGTTC
Microcebus murinus isolate mixed chromosome 15, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033674.1"
NC_033674.1:11725580-11725594
TTTTTATGATTCTTAAAGGGTCATTTTATA11725580TTCATTGACAACATTTAGAAATGATTTTTGTAACTTTAAAATTAA
Microcebus murinus isolate mixed chromosome 17, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033676.1"
NC_033676.1:31382399-31382413
TGGGCACACTGCTTTTCCCAGCTGGTGACT31382399TTCATTGACAACATTTTACAGACTGCAAGATGCCTGTGCTTGGCC
Microcebus murinus isolate mixed chromosome 31, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033690.1"
NC_033690.1:20165393-20165407
ATAGATCACAAAATTACAAAATTGTATGTT20165393TTCATTGACAACATTTGAAAAATAAGGGGGTAGAAAAACCTGTTG
Takifugu rubripes chromosome 6, fTakRub1.2, whole genome shotgun sequence.
taxonomy:"31033", bioproject:"PRJNA543527", refseq:"NC_042290.1"
NC_042290.1:2918971-2918985
GATTTAAAAATATATATATTTATTTTTTAC2918971TTCATTGACAACATTGTCTTAGTTGTGACTGATTAATACTATGAT
Takifugu rubripes chromosome 10, fTakRub1.2, whole genome shotgun sequence.
taxonomy:"31033", bioproject:"PRJNA543527", refseq:"NC_042294.1"
NC_042294.1:5132124-5132138
TATATTTTTATAATACAGATTATAATTCTT5132124TTCATTGACAACATTTCATTTTCTATTCAAAGTGGATTTTTTCAC
Takifugu rubripes chromosome 19, fTakRub1.2, whole genome shotgun sequence.
taxonomy:"31033", bioproject:"PRJNA543527", refseq:"NC_042303.1"
NC_042303.1:5646396-5646410
ACCTCTCACTCGCCACACTAGTTAAGTTTT5646396TTCATTGACAACATTGATTTCCAAGCCATCCGAATTTTTGTTTGT
Takifugu rubripes chromosome 22, fTakRub1.2, whole genome shotgun sequence.
taxonomy:"31033", bioproject:"PRJNA543527", refseq:"NC_042306.1"
NC_042306.1:14530880-14530894
TGCCACTGTTCTTTTACTGGACCACTGCAG14530880TTCATTGACAACATTAAATATCCCATACATGATTTAAAGACTATT
Epinephelus lanceolatus isolate Andai001 chromosome 6, ASM528154v1, whole genome shotgun sequence.
taxonomy:"310571", bioproject:"PRJNA625542", refseq:"NC_046996.1"
NC_046996.1:43935026-43935040
AGTACTCATATTTACTGTATTTGCAAAACA43935026TTCATTGACAACATTTTTATTTGTTTTCTTACAGTAGTCATAGTA
Epinephelus lanceolatus isolate Andai001 chromosome 7, ASM528154v1, whole genome shotgun sequence.
taxonomy:"310571", bioproject:"PRJNA625542", refseq:"NC_046997.1"
NC_046997.1:6948912-6948926
ATGTCCAAAACTATATTAAAAAAATTCTGC6948912TTCATTGACAACATTTTAAAAAACTGAGTCTGTCTTTGCTACTTA
Epinephelus lanceolatus isolate Andai001 chromosome 11, ASM528154v1, whole genome shotgun sequence.
taxonomy:"310571", bioproject:"PRJNA625542", refseq:"NC_047001.1"
NC_047001.1:42763278-42763292
CTGCGTGCCGCAGGCGAAGTCTGGGGGAAT42763278TTCATTGACAACATTCACTGTGAAACAACATCACGCTTGCTGCAT
Epinephelus lanceolatus isolate Andai001 chromosome 16, ASM528154v1, whole genome shotgun sequence.
taxonomy:"310571", bioproject:"PRJNA625542", refseq:"NC_047006.1"
NC_047006.1:34673923-34673937
CAGTATGAAGAACAGCAACTGATCAGATCC34673923TTCATTGACAACATTGAAAAACAGTCCCTTGATGCAATCAAGAGC
Epinephelus lanceolatus isolate Andai001 chromosome 16, ASM528154v1, whole genome shotgun sequence.
taxonomy:"310571", bioproject:"PRJNA625542", refseq:"NC_047006.1"
NC_047006.1:34715411-34715425
GACTTTGAAGAACAGGAACTGATCAGATCC34715411TTCATTGACAACATTGAACAACAGTCCCTTGATGTAATCAAGAGC
Epinephelus lanceolatus isolate Andai001 chromosome 20, ASM528154v1, whole genome shotgun sequence.
taxonomy:"310571", bioproject:"PRJNA625542", refseq:"NC_047010.1"
NC_047010.1:19014778-19014792
TGTGATTTTCTGCAGTTTTCTCATCTGTAA19014778TTCATTGACAACATTATAAAACTGATTCACTATATGCCTATATAC
Physcomitrella patens ecotype Gransden 2004 chromosome 1, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037253.1"
NC_037253.1:7007265-7007279
TTGTAAATGTAGCAAAGGTGATGGAGGCTT7007265TTCATTGACAACATTCATCAAAATCAAGATAAAAACTTTCTTTAT
Physcomitrella patens ecotype Gransden 2004 chromosome 1, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037253.1"
NC_037253.1:19364215-19364229
TTATAAATGCAGCAAAGAGAATTGAGATTT19364215TTCATTGACAACATTCATTAAAATTAAGATGAAAAATAAAAAATC
Physcomitrella patens ecotype Gransden 2004 chromosome 6, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037258.1"
NC_037258.1:15493709-15493723
TTACAACTATAGTTAAGAGAGTTGAGGCTT15493709TTCATTGACAACATTTATGAAAATCAAGATAAAAAATAAATAAAA
Physcomitrella patens ecotype Gransden 2004 chromosome 7, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037259.1"
NC_037259.1:1939930-1939944
TAGCAAATGCAATAAAAAAAGTTGATGCTA1939930TTCATTGACAACATTCATCTAAATCAAGATGAAGGATAATAAATC
Physcomitrella patens ecotype Gransden 2004 chromosome 10, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037262.1"
NC_037262.1:126907-126921
TTTCAAATGTAGCAAAGAAAGTAGAAGCTT126907TTCATTGACAACATTCATCAAAATCAAGTTGAAGACCTTTTTTTA
Physcomitrella patens ecotype Gransden 2004 chromosome 10, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037262.1"
NC_037262.1:14262459-14262473
TAATGAGATACGTGTATAAGACGCGCAGAT14262459TTCATTGACAACATTATACTCATCTAAGGCATGGAGAGAGACAAA
Physcomitrella patens ecotype Gransden 2004 chromosome 14, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037266.1"
NC_037266.1:3635788-3635802
CTATAAATGCAACAAAGAAGATTGAGGCTT3635788TTCATTGACAACATTTATCAAAATCAAAATAAAGAATAACAAGAT
Physcomitrella patens ecotype Gransden 2004 chromosome 14, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037266.1"
NC_037266.1:10030828-10030842
TTACTAATGTAACAAAGATTATTGATGATT10030828TTCATTGACAACATTTATCAAAATGAAGATGAAGAATAAAAATTC
Physcomitrella patens ecotype Gransden 2004 chromosome 14, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037266.1"
NC_037266.1:10271951-10271965
TCTATCACAAGTAAAAAAATAGCTAAGTTT10271951TTCATTGACAACATTTATCACTATTATAAATTAGCAGGGATATAA
Physcomitrella patens ecotype Gransden 2004 chromosome 16, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037268.1"
NC_037268.1:8758313-8758327
TTACTAATGCAACAAAGAAGGTTGAAGTTT8758313TTCATTGACAACATTGATCAAAACCAAAATAAAAAATAACAAATC
Physcomitrella patens ecotype Gransden 2004 chromosome 16, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037268.1"
NC_037268.1:14830473-14830487
TCTTATAAACAACAAAGAAGGTCAATGCTT14830473TTCATTGACAACATTTATTTAAAAGATATGAAGATCTTAGTTATA
Physcomitrella patens ecotype Gransden 2004 chromosome 23, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037275.1"
NC_037275.1:9715197-9715211
TTGCAAATACAGTAAAGAGAGTTGAAGCTT9715197TTCATTGACAACATTCATCAAAATCAAGATAAAGAATAGCAAATC
Physcomitrella patens ecotype Gransden 2004 chromosome 24, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037276.1"
NC_037276.1:6232060-6232074
TTACAAATGCAGCAAAGGCGATGGAGGCTT6232060TTCATTGACAACATTCATCAAAATCAAGATGAAAACCTTCTTTAT
Physcomitrella patens ecotype Gransden 2004 chromosome 25, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037277.1"
NC_037277.1:2782940-2782954
TTATAAATAGGTTTTAGCTTGTTTTTACTT2782940TTCATTGACAACATTCATCAAAATTAAGGACCAATTATTGACAAC
Physcomitrella patens ecotype Gransden 2004 chromosome 27, Phypa V3, whole genome shotgun sequence.
taxonomy:"3218", bioproject:"PRJNA28131", refseq:"NC_037279.1"
NC_037279.1:2590568-2590582
TTATAAATGTAGCAAAGAAGATAGAGGCCT2590568TTCATTGACAACATTTATTAAAATCTAGATGAAGAATAGAAAATC
Xiphophorus couchianus chromosome 7, X_couchianus-1.0, whole genome shotgun sequence.
taxonomy:"32473", bioproject:"PRJNA516883", refseq:"NC_040234.1"
NC_040234.1:227930-227944
GGCCCACAGAACCACAGAACAACAAACTTC227930TTCATTGACAACATTTTACGGCCGGATTTCGGATGCAAGAGGGAA
Xiphophorus couchianus chromosome 9, X_couchianus-1.0, whole genome shotgun sequence.
taxonomy:"32473", bioproject:"PRJNA516883", refseq:"NC_040236.1"
NC_040236.1:21409852-21409866
AATTAATAGTGAGAGATTCACCAATCAAAA21409852TTCATTGACAACATTCAATTTCCACTTTCTATAAGTTTTGTAAAA
Xiphophorus couchianus chromosome 12, X_couchianus-1.0, whole genome shotgun sequence.
taxonomy:"32473", bioproject:"PRJNA516883", refseq:"NC_040239.1"
NC_040239.1:16107297-16107311
CAGATTACCTTAATTTGCATTCAATGCCTG16107297TTCATTGACAACATTTGTTTCCATATAAGGTCATGAGAAGAAAAA
Xiphophorus couchianus chromosome 18, X_couchianus-1.0, whole genome shotgun sequence.
taxonomy:"32473", bioproject:"PRJNA516883", refseq:"NC_040245.1"
NC_040245.1:8377921-8377935
ACTGTAACATAATTTCCCTTATTGTTGTTA8377921TTCATTGACAACATTGTGTTAATCTGAAGTCACTAATGACTTTAA
Xiphophorus couchianus chromosome 24, X_couchianus-1.0, whole genome shotgun sequence.
taxonomy:"32473", bioproject:"PRJNA516883", refseq:"NC_040251.1"
NC_040251.1:15684064-15684078
TGTTCCTATTAACAGCGACTATCACTAGCC15684064TTCATTGACAACATTATCAGATAGATGACTCATCTGTAACTAAAA
Ziziphus jujuba cultivar Dongzao chromosome 5, ZizJuj_1.1, whole genome shotgun sequence.
taxonomy:"326968", bioproject:"PRJNA315994", refseq:"NC_029683.1"
NC_029683.1:27047576-27047590
AGAACGCCAAATTAGGATAAAATGCTAAAA27047576TTCATTGACAACATTGCCCAATGGCATATTCCCTTGAAAATGCCA
Fusarium verticillioides 7600 chromosome 2, whole genome shotgun sequence.
taxonomy:"334819", bioproject:"PRJNA245136", refseq:"NC_031676.1"
NC_031676.1:3441758-3441772
TTCGGGCGAAGATAATAAGGATCTCTCTTC3441758TTCATTGACAACATTCCAATGAAATCGAATGGATCTGCGATATAC
Fusarium verticillioides 7600 chromosome 9, whole genome shotgun sequence.
taxonomy:"334819", bioproject:"PRJNA245136", refseq:"NC_031683.1"
NC_031683.1:1187030-1187044
CGAGACGAAGAGGGTCAGGACGTGCTGCTT1187030TTCATTGACAACATTTTCCGATTCACTCAGGCCGGTTCCGAGGTG
Papaver somniferum cultivar HN1 chromosome 1, ASM357369v1, whole genome shotgun sequence.
taxonomy:"3469", bioproject:"PRJNA492326", refseq:"NC_039358.1"
NC_039358.1:15780879-15780893
ATCCGAAGCCTCAACCTTCCTTTTTCCCAC15780879TTCATTGACAACATTCATAAAAGGCCCAAGGTTATACTGCTTGTT
Papaver somniferum cultivar HN1 chromosome 2, ASM357369v1, whole genome shotgun sequence.
taxonomy:"3469", bioproject:"PRJNA492326", refseq:"NC_039359.1"
NC_039359.1:197621057-197621071
CATGGATATCCTAACTTCTTGTTGGGAGAT197621057TTCATTGACAACATTTGATAAATGATAAATCCACAAATGTCGAGA
Papaver somniferum cultivar HN1 chromosome 4, ASM357369v1, whole genome shotgun sequence.
taxonomy:"3469", bioproject:"PRJNA492326", refseq:"NC_039361.1"
NC_039361.1:143183340-143183354
CAACTCATGATCCTTAAACAGCCAGGGAGC143183340TTCATTGACAACATTGAAAATATATTAGAAGTTGAGACAGAAATT
Phaseolus vulgaris cultivar G19833 chromosome 1, whole genome shotgun sequence.
taxonomy:"3885", bioproject:"PRJNA240798", refseq:"NC_023759.1"
NC_023759.1:32711707-32711721
TGTAATTTCATCTTACCAATTGAGCCTAGC32711707TTCATTGACAACATTGATCAATTGGTAAGATCAGATTACATCAAC
Vigna radiata var. radiata cultivar VC1973A chromosome 2, Vradiata_ver6, whole genome shotgun sequence.
taxonomy:"3916", bioproject:"PRJNA301363", refseq:"NC_028352.1"
NC_028352.1:21585446-21585460
CACATGATCATGGCCTTACGACCTGCACCA21585446TTCATTGACAACATTTGTTTGAAGCCAGTGACAAACATGGATGAG
Vigna radiata var. radiata cultivar VC1973A chromosome 5, Vradiata_ver6, whole genome shotgun sequence.
taxonomy:"3916", bioproject:"PRJNA301363", refseq:"NC_028355.1"
NC_028355.1:18389727-18389741
GAATAAAGAGAATATATCAGTCACCAACCG18389727TTCATTGACAACATTGTAATTGTATTCTCAACCATTTGCTTTGTG
Vigna radiata var. radiata cultivar VC1973A chromosome 5, Vradiata_ver6, whole genome shotgun sequence.
taxonomy:"3916", bioproject:"PRJNA301363", refseq:"NC_028355.1"
NC_028355.1:29561977-29561991
GTGGTTCTCGTTTTCAAGGTGAATTAATTT29561977TTCATTGACAACATTAATTGTATGGTGATTTGACGATTCATACCG
Vigna radiata var. radiata cultivar VC1973A chromosome 6, Vradiata_ver6, whole genome shotgun sequence.
taxonomy:"3916", bioproject:"PRJNA301363", refseq:"NC_028356.1"
NC_028356.1:25986923-25986937
CATAAATTTAAAGACAATATTATACAAACA25986923TTCATTGACAACATTGTAAATGTTATAGGTAATAATAAATATAAA
Vigna radiata var. radiata cultivar VC1973A chromosome 7, Vradiata_ver6, whole genome shotgun sequence.
taxonomy:"3916", bioproject:"PRJNA301363", refseq:"NC_028357.1"
NC_028357.1:49941508-49941522
TGATGATTCATTCTTAATATCTTATATGAT49941508TTCATTGACAACATTGTCATTTTACACTTGAAACAATATCATTTT
Vigna unguiculata cultivar IT97K-499-35 chromosome 1, ASM411807v1, whole genome shotgun sequence.
taxonomy:"3917", bioproject:"PRJNA521068", refseq:"NC_040279.1"
NC_040279.1:10307296-10307310
GGAATCGTAATTTTTCTGAAATACATTTTC10307296TTCATTGACAACATTGTAGTCAAGTTCTGAGTACACCAATCTGTT
Vigna unguiculata cultivar IT97K-499-35 chromosome 3, ASM411807v1, whole genome shotgun sequence.
taxonomy:"3917", bioproject:"PRJNA521068", refseq:"NC_040281.1"
NC_040281.1:27323728-27323742
GGAATTATAACTTTTCTGTAATACATTTTG27323728TTCATTGACAACATTGTAGTCTAGTTCAAAGTAGATCAATCTATT
Vigna unguiculata cultivar IT97K-499-35 chromosome 3, ASM411807v1, whole genome shotgun sequence.
taxonomy:"3917", bioproject:"PRJNA521068", refseq:"NC_040281.1"
NC_040281.1:35960276-35960290
CGAAACAAATTTATTTATGTTATCCATAGT35960276TTCATTGACAACATTCTGAGTGCATTTTAATTAAACAAATAGTTT
Vigna unguiculata cultivar IT97K-499-35 chromosome 3, ASM411807v1, whole genome shotgun sequence.
taxonomy:"3917", bioproject:"PRJNA521068", refseq:"NC_040281.1"
NC_040281.1:45805643-45805657
ATAATTTAGTATTTTCTCCTTGAAAATATC45805643TTCATTGACAACATTAATGCATTAACTAAGATCTCATAGTATATT
Vigna unguiculata cultivar IT97K-499-35 chromosome 5, ASM411807v1, whole genome shotgun sequence.
taxonomy:"3917", bioproject:"PRJNA521068", refseq:"NC_040283.1"
NC_040283.1:11051310-11051324
CATGAATTTTTGGATAAATTTGTGGTTGTT11051310TTCATTGACAACATTTTAATTTATTCCAAAAATCATGAAGAACAT
Vigna unguiculata cultivar IT97K-499-35 chromosome 6, ASM411807v1, whole genome shotgun sequence.
taxonomy:"3917", bioproject:"PRJNA521068", refseq:"NC_040284.1"
NC_040284.1:1472653-1472667
CATGAAGTTTTGGATAAATTTGTGGTTGTT1472653TTCATTGACAACATTTTAATTTCTTCCAAAAATCATGAAGAGCAT
Vigna unguiculata cultivar IT97K-499-35 chromosome 8, ASM411807v1, whole genome shotgun sequence.
taxonomy:"3917", bioproject:"PRJNA521068", refseq:"NC_040286.1"
NC_040286.1:14215895-14215909
CAATCTTGCCTAGACAAGTTTGTGCTCATA14215895TTCATTGACAACATTCTCATCTATTCTAAGAATCGGGAAGAACAT
Manihot esculenta cultivar AM560-2 chromosome LG10, Manihot esculenta v6, whole genome shotgun sequence.
taxonomy:"3983", bioproject:"PRJNA394209", refseq:"NC_035170.1"
NC_035170.1:23532639-23532653
CAATGTTTCTCTTTCTGTTCGAGAAGATTA23532639TTCATTGACAACATTCCATAAGTAGAAAGAAAATGTCAAACTCTT
Oryza sativa Japonica Group cultivar Nipponbare chromosome 3, IRGSP-1.0.
taxonomy:"39947", bioproject:"PRJNA122", refseq:"NC_029258.1"
NC_029258.1:9682664-9682678
TGATCCCAATAGTTGTTTATTTTTGGACTC9682664TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
Oryza sativa Japonica Group cultivar Nipponbare chromosome 7, IRGSP-1.0.
taxonomy:"39947", bioproject:"PRJNA122", refseq:"NC_029262.1"
NC_029262.1:12705943-12705957
CGTGTGCCTCCTGGATGCACCAATCGGCTG12705943TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
Oryza sativa Japonica Group cultivar Nipponbare chromosome 7, IRGSP-1.0.
taxonomy:"39947", bioproject:"PRJNA122", refseq:"NC_029262.1"
NC_029262.1:24274176-24274190
AGATCTATCTAATTTAGGTGTAGTGCTCTC24274176TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
Oryza sativa Japonica Group cultivar Nipponbare chromosome 9, IRGSP-1.0.
taxonomy:"39947", bioproject:"PRJNA122", refseq:"NC_029264.1"
NC_029264.1:16180672-16180686
CTTTCAAATGATGGTCAAACTAATTATAAA16180672TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Oryza sativa Japonica Group cultivar Nipponbare chromosome 10, IRGSP-1.0.
taxonomy:"39947", bioproject:"PRJNA122", refseq:"NC_029265.1"
NC_029265.1:2282429-2282443
ACAAATATATTCACAATATTGATTCACAGG2282429TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Pomacea canaliculata isolate SZHN2017 linkage group LG1, ASM307304v1, whole genome shotgun sequence.
taxonomy:"400727", bioproject:"PRJNA472795", refseq:"NC_037590.1"
NC_037590.1:29616983-29616997
AAATCAACACATCCATGTGGGCTACATGCC29616983TTCATTGACAACATTGGCAAAAACCTATTTCCATCAAACAGCAGC
Pomacea canaliculata isolate SZHN2017 linkage group LG3, ASM307304v1, whole genome shotgun sequence.
taxonomy:"400727", bioproject:"PRJNA472795", refseq:"NC_037592.1"
NC_037592.1:34546016-34546030
AAAACAACATATCCATGTGGGCTACATGTC34546016TTCATTGACAACATTGGCAAAAAAGCTATCTCCATCAATTAGCAG
Pomacea canaliculata isolate SZHN2017 linkage group LG6, ASM307304v1, whole genome shotgun sequence.
taxonomy:"400727", bioproject:"PRJNA472795", refseq:"NC_037595.1"
NC_037595.1:2755869-2755883
CACTACAATTGAAAAAACACACCTACAGCT2755869TTCATTGACAACATTTTAAATGCTATGCAACAGTCTTGCTTTAAA
Pomacea canaliculata isolate SZHN2017 linkage group LG7, ASM307304v1, whole genome shotgun sequence.
taxonomy:"400727", bioproject:"PRJNA472795", refseq:"NC_037596.1"
NC_037596.1:13822882-13822896
ACACCAGATATCTTTGCTCGGTTCAGCAGT13822882TTCATTGACAACATTTCGACATTTTTAAATAGAAAAATCAAATTA
Pomacea canaliculata isolate SZHN2017 linkage group LG10, ASM307304v1, whole genome shotgun sequence.
taxonomy:"400727", bioproject:"PRJNA472795", refseq:"NC_037599.1"
NC_037599.1:7440664-7440678
GCGAGCCTCCTTCTCATGACAGTTGCGCAT7440664TTCATTGACAACATTTTTAAGTGTGTATTTCCGCCTCGACAAGGC
Pomacea canaliculata isolate SZHN2017 linkage group LG12, ASM307304v1, whole genome shotgun sequence.
taxonomy:"400727", bioproject:"PRJNA472795", refseq:"NC_037601.1"
NC_037601.1:7243122-7243136
ATCATACGAGTCAAGCTGGCTTCTGTAGGT7243122TTCATTGACAACATTATCCTCGCACGCAAGTTCTTCACTTTATAC
Pomacea canaliculata isolate SZHN2017 linkage group LG13, ASM307304v1, whole genome shotgun sequence.
taxonomy:"400727", bioproject:"PRJNA472795", refseq:"NC_037602.1"
NC_037602.1:18691652-18691666
CTGTTGAGTCACCACTTGCTGTTGATACAG18691652TTCATTGACAACATTCATTATACGAAGTGTCCGAATAAGTATTTT
Capsicum annuum cultivar Zunla-1 chromosome 1, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029977.1"
NC_029977.1:269322490-269322504
TCTTTTGATTTTTTACCCCATCTTATTTAG269322490TTCATTGACAACATTATGGTGGGAGTATTTTATGCACAACTTGGA
Capsicum annuum cultivar Zunla-1 chromosome 3, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029979.1"
NC_029979.1:34317738-34317752
AATGTCTTGTCATCCTTATTTACTCGTATT34317738TTCATTGACAACATTGAGATTTTATAGTTGGAATGTGGTCAGAAA
Capsicum annuum cultivar Zunla-1 chromosome 4, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029980.1"
NC_029980.1:71991393-71991407
TTTAATTGATATTGATAACGACTTATTGAT71991393TTCATTGACAACATTACTCATTCATCACTCCTGATTATCTATATA
Capsicum annuum cultivar Zunla-1 chromosome 4, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029980.1"
NC_029980.1:124424171-124424185
ATGCTGTATTTGGACTCCTTCTTGATAGTG124424171TTCATTGACAACATTCTTGTTTATACATAGAGTGGGAAGGAGTAT
Capsicum annuum cultivar Zunla-1 chromosome 5, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029981.1"
NC_029981.1:26977453-26977467
CGCAAGGTTTTGAATCTATTTGTCATAGTT26977453TTCATTGACAACATTTTTGTTCACTCTAAGAGCAAGGAGGATCAT
Capsicum annuum cultivar Zunla-1 chromosome 5, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029981.1"
NC_029981.1:157338887-157338901
CATCAGTTTTTAGATTTGTTTTTCATCATT157338887TTCATTGACAACATTTTGATTTCTTCTAATAATAAGGAGGATCAT
Capsicum annuum cultivar Zunla-1 chromosome 6, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029982.1"
NC_029982.1:11719427-11719441
AGACAATTTAGAAACAAGAGCTAGAGGCAT11719427TTCATTGACAACATTTTCTTTCCAAAATTTGAGCTGATTAGAACC
Capsicum annuum cultivar Zunla-1 chromosome 6, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029982.1"
NC_029982.1:75123906-75123920
AAGAAGTACTTGGACATGTTCATCATATTC75123906TTCATTGACAACATTCTTATCTATTCCCGTAATGAAAATGATCAT
Capsicum annuum cultivar Zunla-1 chromosome 6, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029982.1"
NC_029982.1:105999910-105999924
CAAAGTGTTGCTGATATTTAAAGCGGAAAA105999910TTCATTGACAACATTAATTTTTGAATAAAGTTACCTTGCTCATGT
Capsicum annuum cultivar Zunla-1 chromosome 7, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029983.1"
NC_029983.1:84208131-84208145
TCGTCTATATGTAGCCCAACATGAAAGATA84208131TTCATTGACAACATTGCTCTTCACTTAAGAATCTGAAAAAATCAC
Capsicum annuum cultivar Zunla-1 chromosome 9, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029985.1"
NC_029985.1:47417851-47417865
ATTAATTCAAGATCCTTATCATGTTGTAAT47417851TTCATTGACAACATTATAAGTAAAAATATTTTCAACGATTATATC
Capsicum annuum cultivar Zunla-1 chromosome 11, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029987.1"
NC_029987.1:22461440-22461454
AAGAAATACTTGGATATGTTCATCATAGTC22461440TTCATTGACAACATTCTTGTCTACTCCCACAGTGAACATGATCAT
Capsicum annuum cultivar Zunla-1 chromosome 11, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029987.1"
NC_029987.1:76235812-76235826
TCTTACATAGTTATCCTAACACCAAACATA76235812TTCATTGACAACATTGCCCCTCACTTAAGAAGCTGAAAAGTCACT
Capsicum annuum cultivar Zunla-1 chromosome 12, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029988.1"
NC_029988.1:72809403-72809417
AGGTCTTATTTGGATTCCTTTATTATTGTG72809403TTCATTGACAACATTGCTTTGTATTTGAGGAGTGGAGAGAAGTAT
Solanum lycopersicum cultivar Heinz 1706 chromosome 2, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015439.3"
NC_015439.3:4645266-4645280
CAAAGTTACCTAGATTAATTTGTCATTGTC4645266TTCATTGACAACATTTTGGTATATTAGAAAAATAAGGGAGATCAC
Solanum lycopersicum cultivar Heinz 1706 chromosome 4, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015441.3"
NC_015441.3:8489162-8489176
CACGAACTATATTCAACATTTTAGTCAAAA8489162TTCATTGACAACATTATATATGTACAAAATTTGTATAAAATTATT
Solanum lycopersicum cultivar Heinz 1706 chromosome 5, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015442.3"
NC_015442.3:61833200-61833214
AAGACAACGTGACAAAATTGAAATTTCTAG61833200TTCATTGACAACATTTTAATTAATAACAATTCAATCAATTTTATG
Solanum lycopersicum cultivar Heinz 1706 chromosome 5, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015442.3"
NC_015442.3:64021937-64021951
CAGAATTCAATGAAAGTCGCGAACATACAC64021937TTCATTGACAACATTTTATTGGGCCAGGGTCCAATATTGAGCAAA
Solanum lycopersicum cultivar Heinz 1706 chromosome 7, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015444.3"
NC_015444.3:67920697-67920711
TAATCACAATGGAAGCAAGAATGACAAGTT67920697TTCATTGACAACATTATCCATCACCTGTGACCTATAGCTCATGGG
Solanum lycopersicum cultivar Heinz 1706 chromosome 8, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015445.3"
NC_015445.3:52364833-52364847
CAACGTAACTTAGAAGCTTTCCTCAAATAC52364833TTCATTGACAACATTTTCAATCATATCAATTAAAATATAAGTTTT
Solanum lycopersicum cultivar Heinz 1706 chromosome 10, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015447.3"
NC_015447.3:26532383-26532397
AGAAGTTACCTAAATTCATTTGTCATTGTC26532383TTCATTGACAACATTTTGGTATATTCAAAAAATGTGGGTGAACAC
Solanum lycopersicum cultivar Heinz 1706 chromosome 12, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015449.3"
NC_015449.3:66410890-66410904
AACAAAATAATTGACTCTAAGCTAAAATAA66410890TTCATTGACAACATTTTCTTGCCATGTCCTTGTGTAAATGATCTC
Sesamum indicum cultivar Zhongzhi No. 13 linkage group LG8, S_indicum_v1.0, whole genome shotgun sequence.
taxonomy:"4182", bioproject:"PRJNA268358", refseq:"NC_026152.1"
NC_026152.1:18312293-18312307
ATCGCAATTATGCACTACATCAACATCACC18312293TTCATTGACAACATTATTTTTCTGGATGGTTGTGTGAAAAACACC
Bathycoccus prasinos genomic : Chromosome_14.
taxonomy:"41875", bioproject:"PRJNA394752", refseq:"NC_023995.1"
NC_023995.1:363866-363880
TCCAAATTTCTAAAAAATATATTAATGGAT363866TTCATTGACAACATTGAGAAGTCAAGGCACGTTTCAAGACAACTT
Cynara cardunculus var. scolymus isolate 2C chromosome LG 13, CcrdV1, whole genome shotgun sequence.
taxonomy:"59895", bioproject:"PRJNA453787", refseq:"NC_037540.1"
NC_037540.1:29938143-29938157
CGAGAATATCTTGATAAGTTTATGATTGTG29938143TTCATTGACAACATTCTTATTTACTCAAAGACAGAGGCAGAACAT
Cynara cardunculus var. scolymus isolate 2C chromosome LG 17, CcrdV1, whole genome shotgun sequence.
taxonomy:"59895", bioproject:"PRJNA453787", refseq:"NC_037544.1"
NC_037544.1:24418953-24418967
AATCCCAAACCAAATTTTTTTTTACTTGTG24418953TTCATTGACAACATTTAGGCTCTAAATAAATCATGAACACGTTAT
Cynara cardunculus var. scolymus isolate 2C chromosome LG 17, CcrdV1, whole genome shotgun sequence.
taxonomy:"59895", bioproject:"PRJNA453787", refseq:"NC_037544.1"
NC_037544.1:29685572-29685586
TTTCAAACCAAAAAAAGAAACATACGTGTG29685572TTCATTGACAACATTTAGTCTCTAAATAAATTATCAGAACATGAT
Chlorocebus sabaeus isolate 1994-021 chromosome 3, Chlorocebus_sabeus 1.1, whole genome shotgun sequence.
taxonomy:"60711", bioproject:"PRJNA215854", refseq:"NC_023644.1"
NC_023644.1:63217385-63217399
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA63217385TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
Chlorocebus sabaeus isolate 1994-021 chromosome 4, Chlorocebus_sabeus 1.1, whole genome shotgun sequence.
taxonomy:"60711", bioproject:"PRJNA215854", refseq:"NC_023645.1"
NC_023645.1:43351105-43351119
TTAAGTCTTATTAACTTAAATTGCTATTAA43351105TTCATTGACAACATTAATAACTGTATAACAAACTATGCAAGCTTT
Chlorocebus sabaeus isolate 1994-021 chromosome 7, Chlorocebus_sabeus 1.1, whole genome shotgun sequence.
taxonomy:"60711", bioproject:"PRJNA215854", refseq:"NC_023648.1"
NC_023648.1:14043245-14043259
CTTAAATCACGATCAATGTCATGTCACAGT14043245TTCATTGACAACATTTCTTCCTTTTTAGCAGTATATAAAATAGTG
Chlorocebus sabaeus isolate 1994-021 chromosome 7, Chlorocebus_sabeus 1.1, whole genome shotgun sequence.
taxonomy:"60711", bioproject:"PRJNA215854", refseq:"NC_023648.1"
NC_023648.1:95403518-95403532
CAGAATATATTATCACTTTGAACACAGATT95403518TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
Chlorocebus sabaeus isolate 1994-021 chromosome 7, Chlorocebus_sabeus 1.1, whole genome shotgun sequence.
taxonomy:"60711", bioproject:"PRJNA215854", refseq:"NC_023648.1"
NC_023648.1:112164397-112164411
TAAAACCTCTGATTTTGTGTAACACTCCTT112164397TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTACAT
Chlorocebus sabaeus isolate 1994-021 chromosome 7, Chlorocebus_sabeus 1.1, whole genome shotgun sequence.
taxonomy:"60711", bioproject:"PRJNA215854", refseq:"NC_023648.1"
NC_023648.1:127465226-127465240
TTTGGACCCCCAGATCAGTCTTCATATTCT127465226TTCATTGACAACATTCATGAAGTTCTGCAGAAGTTAAATAGAATT
Chlorocebus sabaeus isolate 1994-021 chromosome 9, Chlorocebus_sabeus 1.1, whole genome shotgun sequence.
taxonomy:"60711", bioproject:"PRJNA215854", refseq:"NC_023650.1"
NC_023650.1:32040642-32040656
GTTAAATGCCTCTATTCTAATTTCTGGTAG32040642TTCATTGACAACATTTGGTGTTCCTTGGCTTGGAGATGCATCACT
Chlorocebus sabaeus isolate 1994-021 chromosome 13, Chlorocebus_sabeus 1.1, whole genome shotgun sequence.
taxonomy:"60711", bioproject:"PRJNA215854", refseq:"NC_023654.1"
NC_023654.1:81143559-81143573
TACCAGCTTTTGCTTTATTTTAATAACAGT81143559TTCATTGACAACATTGGCTTCTAAAATTGTGTAGAAATATTAACT
Chlorocebus sabaeus isolate 1994-021 chromosome 16, Chlorocebus_sabeus 1.1, whole genome shotgun sequence.
taxonomy:"60711", bioproject:"PRJNA215854", refseq:"NC_023657.1"
NC_023657.1:13438276-13438290
GCCTCTGGGCCTGTGTTAGATGGGCCATGC13438276TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
Chlorocebus sabaeus isolate 1994-021 chromosome 27, Chlorocebus_sabeus 1.1, whole genome shotgun sequence.
taxonomy:"60711", bioproject:"PRJNA215854", refseq:"NC_023668.1"
NC_023668.1:29161092-29161106
TTCTCTCAACAAAGTAGATATCGATAAATA29161092TTCATTGACAACATTTGAATTTTGTGTTTCCCAAGAGCTGTGGGA
Caldicellulosiruptor obsidiansis OB47, complete sequence.
taxonomy:"608506", bioproject:"PRJNA224116", refseq:"NC_014392.1"
NC_014392.1:2291756-2291770
GCAGCAACAGAATTGCCTATTATAACATAC2291756TTCATTGACAACATTTCCCCCTTTTTAGACCTCTTTGATTTCAAG
Lynx canadensis isolate LIC74 chromosome A3, mLynCan4_v1.p, whole genome shotgun sequence.
taxonomy:"61383", bioproject:"PRJNA558991", refseq:"NC_044305.1"
NC_044305.1:69440821-69440835
TCTACAAATGCAAGCCAGAAATTAGGAAGA69440821TTCATTGACAACATTTTACTTCCATTGTGGCAACAATTTTCCTTT
Lynx canadensis isolate LIC74 chromosome B2, mLynCan4_v1.p, whole genome shotgun sequence.
taxonomy:"61383", bioproject:"PRJNA558991", refseq:"NC_044307.1"
NC_044307.1:67539160-67539174
GTTGGGGCCAGAGTTCCATCCAGAATTAAG67539160TTCATTGACAACATTCCCCTCACCACTCACTCTTTCCCAGACTTT
Lynx canadensis isolate LIC74 chromosome C1, mLynCan4_v1.p, whole genome shotgun sequence.
taxonomy:"61383", bioproject:"PRJNA558991", refseq:"NC_044310.1"
NC_044310.1:68252585-68252599
CAACTGAGCTAAAGGGGAGAAGGAGAGTAG68252585TTCATTGACAACATTCTCTTAATCCTAATATATTTGTTTGGGGAA
Lynx canadensis isolate LIC74 chromosome C2, mLynCan4_v1.p, whole genome shotgun sequence.
taxonomy:"61383", bioproject:"PRJNA558991", refseq:"NC_044311.1"
NC_044311.1:7829330-7829344
TTTCACTTTCCTGGCCTTAATGGAACCATG7829330TTCATTGACAACATTTTCAAAAATCTACATCTGTGCTACGTTGTT
Lynx canadensis isolate LIC74 chromosome D2, mLynCan4_v1.p, whole genome shotgun sequence.
taxonomy:"61383", bioproject:"PRJNA558991", refseq:"NC_044313.1"
NC_044313.1:86241931-86241945
TACAGCTAAAAAGAGAAGCCATGAGCTTGA86241931TTCATTGACAACATTGTTTTCAGAGCATGACAGTTGCAAGCCCTG
Lynx canadensis isolate LIC74 chromosome E3, mLynCan4_v1.p, whole genome shotgun sequence.
taxonomy:"61383", bioproject:"PRJNA558991", refseq:"NC_044318.1"
NC_044318.1:11928224-11928238
TTGTGGGCTACACATTATTCTAAAAAAAAA11928224TTCATTGACAACATTTAGAAATTAAGAGTTCACATGAAAATCTGT
Rhinopithecus roxellana isolate Shanxi Qingling chromosome 2, ASM756505v1, whole genome shotgun sequence.
taxonomy:"61622", bioproject:"PRJNA565017", refseq:"NC_044550.1"
NC_044550.1:24381890-24381904
CCCCTCCAAGAGTGGTATTTTTTAATGTGG24381890TTCATTGACAACATTTTCTCTAGCAATTTTTGTTTTGTCTGGATT
Rhinopithecus roxellana isolate Shanxi Qingling chromosome 2, ASM756505v1, whole genome shotgun sequence.
taxonomy:"61622", bioproject:"PRJNA565017", refseq:"NC_044550.1"
NC_044550.1:85833669-85833683
CAGAATATATTATCGCTTTGAACACAGATT85833669TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
Rhinopithecus roxellana isolate Shanxi Qingling chromosome 2, ASM756505v1, whole genome shotgun sequence.
taxonomy:"61622", bioproject:"PRJNA565017", refseq:"NC_044550.1"
NC_044550.1:96055154-96055168
TAAAACCTCTGATTTTGTGTAACCCTCCTT96055154TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTACAT
Rhinopithecus roxellana isolate Shanxi Qingling chromosome 3, ASM756505v1, whole genome shotgun sequence.
taxonomy:"61622", bioproject:"PRJNA565017", refseq:"NC_044551.1"
NC_044551.1:126674965-126674979
TTAAGTCTTATTAACTTAAGTTGCTATTAT126674965TTCATTGACAACATTAATAACTGTATAACAAACTATGCAAGCTTC
Rhinopithecus roxellana isolate Shanxi Qingling chromosome 5, ASM756505v1, whole genome shotgun sequence.
taxonomy:"61622", bioproject:"PRJNA565017", refseq:"NC_044553.1"
NC_044553.1:71610584-71610598
TCTCATAAACAGTAGAGAACATGCACTTCA71610584TTCATTGACAACATTCTGAAATTAATTTTGTTAGCAGACAGGTAT
Rhinopithecus roxellana isolate Shanxi Qingling chromosome 12, ASM756505v1, whole genome shotgun sequence.
taxonomy:"61622", bioproject:"PRJNA565017", refseq:"NC_044560.1"
NC_044560.1:131349940-131349954
GAGCCACCATGCCCAGCCTATCTTAGCTTT131349940TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Rhinopithecus roxellana isolate Shanxi Qingling chromosome 15, ASM756505v1, whole genome shotgun sequence.
taxonomy:"61622", bioproject:"PRJNA565017", refseq:"NC_044563.1"
NC_044563.1:24690224-24690238
TTGAGTTTCCAGGAACATAGATATGTCTTG24690224TTCATTGACAACATTCTACCATTGAGGACAGTGAATAGAGCAAAC
Rhinopithecus roxellana isolate Shanxi Qingling chromosome 18, ASM756505v1, whole genome shotgun sequence.
taxonomy:"61622", bioproject:"PRJNA565017", refseq:"NC_044566.1"
NC_044566.1:15433709-15433723
GCAGTCTGGAGGTTCTCCCTGGAGGCTCTA15433709TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
Rhinopithecus roxellana isolate Shanxi Qingling chromosome 19, ASM756505v1, whole genome shotgun sequence.
taxonomy:"61622", bioproject:"PRJNA565017", refseq:"NC_044567.1"
NC_044567.1:36476236-36476250
GCCTCTGGGCCTATGTTAGATGGGCCATGC36476236TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
Rhinopithecus roxellana isolate Shanxi Qingling chromosome 21, ASM756505v1, whole genome shotgun sequence.
taxonomy:"61622", bioproject:"PRJNA565017", refseq:"NC_044569.1"
NC_044569.1:8672590-8672604
AGCTACAGCACTCTACAGTGGACACCCACA8672590TTCATTGACAACATTGTTTCCACAGGAAAACTTACTCTAATTTCA
Schistosoma mansoni strain Puerto Rico chromosome 1, complete genome.
taxonomy:"6183", bioproject:"PRJNA39937", refseq:"NC_031495.1"
NC_031495.1:17027244-17027258
AAGTTTATTAGGCTCATAATTCACAAAGCG17027244TTCATTGACAACATTTAAAATACAGTGCCTCTATAATGCAACTGA
Schistosoma mansoni strain Puerto Rico chromosome 4, complete genome.
taxonomy:"6183", bioproject:"PRJNA39937", refseq:"NC_031498.1"
NC_031498.1:21725387-21725401
AGAAGAAGAAATTGAAAGTGAAGAATTCAA21725387TTCATTGACAACATTTCAATCATGTAATACTGAAAAGAATTTAAA
Nomascus leucogenys isolate Asia chromosome 5, Asia_NLE_v1, whole genome shotgun sequence.
taxonomy:"61853", bioproject:"PRJNA564096", refseq:"NC_044385.1"
NC_044385.1:109789940-109789954
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA109789940TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
Nomascus leucogenys isolate Asia chromosome 6, Asia_NLE_v1, whole genome shotgun sequence.
taxonomy:"61853", bioproject:"PRJNA564096", refseq:"NC_044386.1"
NC_044386.1:9126922-9126936
CATAGGTTGATAAAGAATCATGCATATATA9126922TTCATTGACAACATTGAATATCCATGAAACCATTGTCCTCACTTG
Nomascus leucogenys isolate Asia chromosome 7b, Asia_NLE_v1, whole genome shotgun sequence.
taxonomy:"61853", bioproject:"PRJNA564096", refseq:"NC_044387.1"
NC_044387.1:57275929-57275943
TTGCTGTGAAGGATAAGGGATATGATTGGA57275929TTCATTGACAACATTGGAATAGATATGGTAGATTATTATATCAGT
Nomascus leucogenys isolate Asia chromosome 7b, Asia_NLE_v1, whole genome shotgun sequence.
taxonomy:"61853", bioproject:"PRJNA564096", refseq:"NC_044387.1"
NC_044387.1:69549247-69549261
CAGAATATATTATCACTTTAAACACAGATT69549247TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
Nomascus leucogenys isolate Asia chromosome 7b, Asia_NLE_v1, whole genome shotgun sequence.
taxonomy:"61853", bioproject:"PRJNA564096", refseq:"NC_044387.1"
NC_044387.1:101666092-101666106
TTTGGACCCCCAAATCAGTCTTCATTTTCT101666092TTCATTGACAACATTCATTAAGTTCTGCAGAAATTAAACAGAATT
Nomascus leucogenys isolate Asia chromosome 8, Asia_NLE_v1, whole genome shotgun sequence.
taxonomy:"61853", bioproject:"PRJNA564096", refseq:"NC_044388.1"
NC_044388.1:36381196-36381210
ATATTTTAAAATTCATCCATATTTCCACTT36381196TTCATTGACAACATTATTAAGTTTTTTGTGTCTTTTTTCAAATTA
Nomascus leucogenys isolate Asia chromosome 17, Asia_NLE_v1, whole genome shotgun sequence.
taxonomy:"61853", bioproject:"PRJNA564096", refseq:"NC_044397.1"
NC_044397.1:29288003-29288017
GCAGTGCCTGGCCTGAGTCAGCACATTAGC29288003TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
Caenorhabditis elegans chromosome III.
taxonomy:"6239", bioproject:"PRJNA158", refseq:"NC_003281.10"
NC_003281.10:5229507-5229521
CGTGACCAGGAAGGACAAGATGTGCTTCTT5229507TTCATTGACAACATTTTCCGTTTCACCCAGGCTGGATCTGAAGTG
Archocentrus centrarchus isolate MPI-CPG fArcCen1 chromosome 3, fArcCen1, whole genome shotgun sequence.
taxonomy:"63155", bioproject:"PRJNA559550", refseq:"NC_044348.1"
NC_044348.1:19585709-19585723
GAAATATTTAAATTCAGTTAATGAAAATTG19585709TTCATTGACAACATTTCCTAGCCCACAATATTTCTTCCTGCCTAC
Archocentrus centrarchus isolate MPI-CPG fArcCen1 chromosome 5, fArcCen1, whole genome shotgun sequence.
taxonomy:"63155", bioproject:"PRJNA559550", refseq:"NC_044350.1"
NC_044350.1:11286969-11286983
TTTTTTTTGTTGCCTCTCACTTCAGGAAGC11286969TTCATTGACAACATTAATAGTCTCTGGGATCTCTAACCAGTGATT
Archocentrus centrarchus isolate MPI-CPG fArcCen1 chromosome 11, fArcCen1, whole genome shotgun sequence.
taxonomy:"63155", bioproject:"PRJNA559550", refseq:"NC_044356.1"
NC_044356.1:27892804-27892818
GAAGACAACTAAAGAGTGTGACCTCATTCT27892804TTCATTGACAACATTTAACCAAGTCAAGAACTCTCTCGAGAAGGT
Archocentrus centrarchus isolate MPI-CPG fArcCen1 chromosome 11, fArcCen1, whole genome shotgun sequence.
taxonomy:"63155", bioproject:"PRJNA559550", refseq:"NC_044356.1"
NC_044356.1:32333796-32333810
ATTATCATCAAAATGATGTAGTTTATAGTT32333796TTCATTGACAACATTAAGATTGGTTGAAACATTTTTTTTTTCCAG
Archocentrus centrarchus isolate MPI-CPG fArcCen1 chromosome 20, fArcCen1, whole genome shotgun sequence.
taxonomy:"63155", bioproject:"PRJNA559550", refseq:"NC_044365.1"
NC_044365.1:21135346-21135360
GATAAACTAATTTTTTTTTTTTTAGGTTTA21135346TTCATTGACAACATTTTTTACAAACATTAAATATGATCACATTTC
Caldicellulosiruptor owensensis OL, complete sequence.
taxonomy:"632518", bioproject:"PRJNA224116", refseq:"NC_014657.1"
NC_014657.1:2207096-2207110
GCAGCAACAGAATTGCCTATTACAACATAC2207096TTCATTGACAACATTTCCCCCTTTTTTACACCTCTTTGATTTCAA
Anabas testudineus chromosome 6, fAnaTes1.2, whole genome shotgun sequence.
taxonomy:"64144", bioproject:"PRJNA489257", refseq:"NC_046615.1"
NC_046615.1:11354462-11354476
TCCTTTGATTTAATTCAGTTTGTTAGATTT11354462TTCATTGACAACATTTATAGTCTTTTACTAAGACTACAGTTTGCA
Anabas testudineus chromosome 7, fAnaTes1.2, whole genome shotgun sequence.
taxonomy:"64144", bioproject:"PRJNA489257", refseq:"NC_046616.1"
NC_046616.1:24884683-24884697
TGTAACCCCAACCTCCAGGTATTCAATGTG24884683TTCATTGACAACATTGATGAGAGGCTCCCAAGAATTGCTTTATTT
Anabas testudineus chromosome 17, fAnaTes1.2, whole genome shotgun sequence.
taxonomy:"64144", bioproject:"PRJNA489257", refseq:"NC_046626.1"
NC_046626.1:10458439-10458453
TCTTGTATCTCTGTTATAAGCATGTTGTAT10458439TTCATTGACAACATTAAGGTGTAAAACCCTCCACTACATCTGTTT
Anabas testudineus chromosome 21, fAnaTes1.2, whole genome shotgun sequence.
taxonomy:"64144", bioproject:"PRJNA489257", refseq:"NC_046629.1"
NC_046629.1:12513223-12513237
TCTGCACTAGTATCTAATACTACAAGCCAT12513223TTCATTGACAACATTTTGGTCATGCTAAAATACTCCACCACCAGC
Ictalurus punctatus breed USDA103 chromosome 10, IpCoco_1.2, whole genome shotgun sequence.
taxonomy:"7998", bioproject:"PRJNA327588", refseq:"NC_030425.1"
NC_030425.1:24639191-24639205
CGTGATCAGGAGGGACAGGACGTGCTGCTT24639191TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTC
Ictalurus punctatus breed USDA103 chromosome 23, IpCoco_1.2, whole genome shotgun sequence.
taxonomy:"7998", bioproject:"PRJNA327588", refseq:"NC_030438.1"
NC_030438.1:11872154-11872168
AGAGTTTTTGAAGCTTTTAATTTCGAAGTT11872154TTCATTGACAACATTAAGGTCACTTACTTGACGACCAGACCATGA
Esox lucius isolate Castlegar BC 2017 Female #2 linkage group LG04, Eluc_v4, whole genome shotgun sequence.
taxonomy:"8010", bioproject:"PRJNA268215", refseq:"NC_025971.4"
NC_025971.4:14290370-14290384
TTTTTTGATGCTGTCGTTGAAATGTATTGT14290370TTCATTGACAACATTTGCTCATAAAAAGGCTGCGGAAGAAGGTGA
Esox lucius isolate Castlegar BC 2017 Female #2 linkage group LG05, Eluc_v4, whole genome shotgun sequence.
taxonomy:"8010", bioproject:"PRJNA268215", refseq:"NC_025972.4"
NC_025972.4:6490773-6490787
TGACTCATTAATTGACAATGTTTTGACCAG6490773TTCATTGACAACATTTTGACCAGTTCATTGAAGGCATTTTGACCG
Esox lucius isolate Castlegar BC 2017 Female #2 linkage group LG05, Eluc_v4, whole genome shotgun sequence.
taxonomy:"8010", bioproject:"PRJNA268215", refseq:"NC_025972.4"
NC_025972.4:6490842-6490856
TGACCGGTTCACTGAACACATTTTGACCAG6490842TTCATTGACAACATTTTGACCGGTTCATTGACAGTGTTTTCAGTG
Esox lucius isolate Castlegar BC 2017 Female #2 linkage group LG13, Eluc_v4, whole genome shotgun sequence.
taxonomy:"8010", bioproject:"PRJNA268215", refseq:"NC_025980.4"
NC_025980.4:16250439-16250453
GGAGCGTCTGTCCATTCTCATTGATCATGT16250439TTCATTGACAACATTTCAGTTGCGCTAACTTTACCTTGCAAAACA
Esox lucius isolate Castlegar BC 2017 Female #2 linkage group LG21, Eluc_v4, whole genome shotgun sequence.
taxonomy:"8010", bioproject:"PRJNA268215", refseq:"NC_025988.4"
NC_025988.4:22177076-22177090
TGCACGTTTGTCAGTTCTCCTTGCAGACGT22177076TTCATTGACAACATTTGAGCTGCGCTAAGTTCAGCCCACAATTAG
Esox lucius isolate Castlegar BC 2017 Female #2 linkage group LG22, Eluc_v4, whole genome shotgun sequence.
taxonomy:"8010", bioproject:"PRJNA268215", refseq:"NC_025989.4"
NC_025989.4:3774091-3774105
ACATCAGTTGATCTACTTTGAAATGACTCC3774091TTCATTGACAACATTCATTTACATTATATGAGCCGTTCAGTTGTT
Esox lucius isolate Castlegar BC 2017 Female #2 linkage group LG23, Eluc_v4, whole genome shotgun sequence.
taxonomy:"8010", bioproject:"PRJNA268215", refseq:"NC_025990.4"
NC_025990.4:12233343-12233357
AAAGAGGCTTGTGAACGTCAAAGATACATT12233343TTCATTGACAACATTCTAACAGTGTAATCTTTATGGTAGAATGGT
Oncorhynchus kisutch isolate 150728-3 linkage group LG1, Okis_V2, whole genome shotgun sequence.
taxonomy:"8019", bioproject:"PRJNA378663", refseq:"NC_034174.2"
NC_034174.2:66000270-66000284
GTGTTAAATGTTTTTATAATATTGACAAGC66000270TTCATTGACAACATTCTAAACCAATATCATATCTGTATGACTTGA
Oncorhynchus kisutch isolate 150728-3 linkage group LG1, Okis_V2, whole genome shotgun sequence.
taxonomy:"8019", bioproject:"PRJNA378663", refseq:"NC_034174.2"
NC_034174.2:66067268-66067282
GTTTAAAAAAATATATATATATTAACAAGC66067268TTCATTGACAACATTCTAAATGGATATCATATCCGTACGAATTGA
Oncorhynchus kisutch isolate 150728-3 linkage group LG5, Okis_V2, whole genome shotgun sequence.
taxonomy:"8019", bioproject:"PRJNA378663", refseq:"NC_034178.2"
NC_034178.2:50649111-50649125
GACAAGAGGAACACCTATGTGAGAATGCTG50649111TTCATTGACAACATTTAAGCATTCAAAACTATTGTTCCCTCCAAG
Oncorhynchus kisutch isolate 150728-3 linkage group LG17, Okis_V2, whole genome shotgun sequence.
taxonomy:"8019", bioproject:"PRJNA378663", refseq:"NC_034190.2"
NC_034190.2:18430919-18430933
GAAGCCGCCAACAGATAGCCTACCACGCAA18430919TTCATTGACAACATTGCCTGTGCTGGCGGAAGTAATAGCTTTCCT
Oncorhynchus kisutch isolate 150728-3 linkage group LG19, Okis_V2, whole genome shotgun sequence.
taxonomy:"8019", bioproject:"PRJNA378663", refseq:"NC_034192.2"
NC_034192.2:47913607-47913621
TGAGTACCAAATAAAGACAAAGTTTCGCAG47913607TTCATTGACAACATTTTAGCTAAGAGCTTTCCATTTATATATAGA
Oncorhynchus kisutch isolate 150728-3 linkage group LG20, Okis_V2, whole genome shotgun sequence.
taxonomy:"8019", bioproject:"PRJNA378663", refseq:"NC_034193.2"
NC_034193.2:20534040-20534054
AGACCATAGTCCCACTCAGTGCTTTATTTC20534040TTCATTGACAACATTGATTCATTTTTAGCATCTTAGCTAATCGCT
Oncorhynchus mykiss isolate Swanson chromosome 2, Omyk_1.0, whole genome shotgun sequence.
taxonomy:"8022", bioproject:"PRJNA390662", refseq:"NC_035078.1"
NC_035078.1:30975815-30975829
CACAATTATCAGTTTGGTTTATATTGCCTA30975815TTCATTGACAACATTCATTCAGGTAGAGACACATTAGCACCTTGG
Oncorhynchus mykiss isolate Swanson chromosome 7, Omyk_1.0, whole genome shotgun sequence.
taxonomy:"8022", bioproject:"PRJNA390662", refseq:"NC_035083.1"
NC_035083.1:34259473-34259487
TGCACACTGTTAAAGCTCCCAATTCACTGT34259473TTCATTGACAACATTTCGATTCGAAACAGATCTTCATCAGGTTCA
Oncorhynchus mykiss isolate Swanson chromosome 14, Omyk_1.0, whole genome shotgun sequence.
taxonomy:"8022", bioproject:"PRJNA390662", refseq:"NC_035090.1"
NC_035090.1:65220709-65220723
TTGAGTACCAAATAAAGACAAAGTTCGCAG65220709TTCATTGACAACATTTTAGGTAAGAGCTTTCCATTTATATATATA
Oncorhynchus mykiss isolate Swanson chromosome 16, Omyk_1.0, whole genome shotgun sequence.
taxonomy:"8022", bioproject:"PRJNA390662", refseq:"NC_035092.1"
NC_035092.1:16702700-16702714
AGACCATAGTCCCACTCAGTGCTTTATTTC16702700TTCATTGACAACATTGATTCATTTTTAGCATCTTAGCTAATCGCT
Oncorhynchus mykiss isolate Swanson chromosome 17, Omyk_1.0, whole genome shotgun sequence.
taxonomy:"8022", bioproject:"PRJNA390662", refseq:"NC_035093.1"
NC_035093.1:11010104-11010118
TTTGGACTTATTTGACTCAGGTATCTGGCT11010104TTCATTGACAACATTATTTGAAAGAATTTAGGGTTAGTTTGAAGG
Oncorhynchus mykiss isolate Swanson chromosome 17, Omyk_1.0, whole genome shotgun sequence.
taxonomy:"8022", bioproject:"PRJNA390662", refseq:"NC_035093.1"
NC_035093.1:32014002-32014016
ACACATCATTTATTTGTGAATGATTCTTCA32014002TTCATTGACAACATTTTGGCAGTAAGCTATCTCCATAATATATGC
Oncorhynchus mykiss isolate Swanson chromosome 29, Omyk_1.0, whole genome shotgun sequence.
taxonomy:"8022", bioproject:"PRJNA390662", refseq:"NC_035105.1"
NC_035105.1:10471544-10471558
AAATTTGGTCTAGGTTGTAGTCTGGACCTG10471544TTCATTGACAACATTTATAGCAAACAACAAATGAACAAGGGGCTT
Oncorhynchus nerka isolate On170113-E2 linkage group LG6, Oner_1.0, whole genome shotgun sequence.
taxonomy:"8023", bioproject:"PRJNA548514", refseq:"NC_042540.1"
NC_042540.1:49150194-49150208
TGAGTACCAAATAAAGACAAAGTTTCGCAG49150194TTCATTGACAACATTTTAGCTAAGAGCTTTCCATTTATATATAGA
Oncorhynchus nerka isolate On170113-E2 linkage group LG7, Oner_1.0, whole genome shotgun sequence.
taxonomy:"8023", bioproject:"PRJNA548514", refseq:"NC_042541.1"
NC_042541.1:4551962-4551976
TATAAGTGCATCACAGGGGGCGTTGGCCAA4551962TTCATTGACAACATTGGCTTTAACTTGCTTATATAGAGCGGGTAC
Oncorhynchus nerka isolate On170113-E2 linkage group LG10, Oner_1.0, whole genome shotgun sequence.
taxonomy:"8023", bioproject:"PRJNA548514", refseq:"NC_042544.1"
NC_042544.1:30296350-30296364
AACCGTAATTAAAACAAGAGTAACAGCTTG30296350TTCATTGACAACATTGCGCTGCTCAGGTGAGTCAATGTTTCACTG
Oncorhynchus nerka isolate On170113-E2 linkage group LG11, Oner_1.0, whole genome shotgun sequence.
taxonomy:"8023", bioproject:"PRJNA548514", refseq:"NC_042545.1"
NC_042545.1:16296360-16296374
ACCAGAACACATGATATGCTCTCAACTATG16296360TTCATTGACAACATTTCAACCACTAAAGGGGCAATCCACAGTTGA
Oncorhynchus nerka isolate On170113-E2 linkage group LG12, Oner_1.0, whole genome shotgun sequence.
taxonomy:"8023", bioproject:"PRJNA548514", refseq:"NC_042546.1"
NC_042546.1:26888408-26888422
ATAAAATATCTCTCATTTCCAGCTACCACA26888408TTCATTGACAACATTAACCATTTCTCCACTGTATTTCTGATTCAT
Oncorhynchus nerka isolate On170113-E2 linkage group LG13, Oner_1.0, whole genome shotgun sequence.
taxonomy:"8023", bioproject:"PRJNA548514", refseq:"NC_042547.1"
NC_042547.1:14088112-14088126
GCTGCCCTGTCTTTCTATTATCATGTTGTA14088112TTCATTGACAACATTGGAGGCTTGTTTTGTGAAGCATTAATGAGA
Oncorhynchus nerka isolate On170113-E2 linkage group LG15, Oner_1.0, whole genome shotgun sequence.
taxonomy:"8023", bioproject:"PRJNA548514", refseq:"NC_042549.1"
NC_042549.1:13836672-13836686
ATTACGCAAAACACGGGGTGCATTGGCCAA13836672TTCATTGACAACATTTTGCTTTAGTTTGCTTATATAGAGCGGGTA
Oncorhynchus nerka isolate On170113-E2 linkage group LG22, Oner_1.0, whole genome shotgun sequence.
taxonomy:"8023", bioproject:"PRJNA548514", refseq:"NC_042556.1"
NC_042556.1:58982737-58982751
GTTATTGTCTAAATTCTTATTATTTTAATT58982737TTCATTGACAACATTCACATTTTTGAAGTCATCAGAGACATTACT
Oncorhynchus nerka isolate On170113-E2 linkage group LG23, Oner_1.0, whole genome shotgun sequence.
taxonomy:"8023", bioproject:"PRJNA548514", refseq:"NC_042557.1"
NC_042557.1:11636344-11636358
AGACCATAGTCTCACTCAGTGCTTTATTTC11636344TTCATTGACAACATTGATTCATTTTTAGCATCTTAGCTAATCGCT
Oncorhynchus nerka isolate On170113-E2 linkage group LG28, Oner_1.0, whole genome shotgun sequence.
taxonomy:"8023", bioproject:"PRJNA548514", refseq:"NC_042562.1"
NC_042562.1:45681470-45681484
AAAATAGATCAGCCGTTTCCAGCTGCAATA45681470TTCATTGACAACATTGACAATGTCTACACTGTATTTCTGATCAAT
Salmo salar isolate Sally breed double haploid chromosome ssa02, ICSASG_v2, whole genome shotgun sequence.
taxonomy:"8030", bioproject:"PRJNA287919", refseq:"NC_027301.1"
NC_027301.1:69890951-69890965
TGGGCTGTCTGCGTCAGAGTTGTTGCCCCC69890951TTCATTGACAACATTACAGGGGTTAAAATGCTGCACTGTCAATAA
Salmo salar isolate Sally breed double haploid chromosome ssa04, ICSASG_v2, whole genome shotgun sequence.
taxonomy:"8030", bioproject:"PRJNA287919", refseq:"NC_027303.1"
NC_027303.1:31805498-31805512
GACTGTAAGCAACCGTAATTAAACAGCTTG31805498TTCATTGACAACATTGCGCTGCTCAGGTGAGTCAATGTTTCACTG
Salmo salar isolate Sally breed double haploid chromosome ssa12, ICSASG_v2, whole genome shotgun sequence.
taxonomy:"8030", bioproject:"PRJNA287919", refseq:"NC_027311.1"
NC_027311.1:43010353-43010367
ACACATAATTTATTTGTGAATGATTCTTCA43010353TTCATTGACAACATTTTGGCAGTAAGCTATCTCCATAATATATGC
Salmo salar isolate Sally breed double haploid chromosome ssa13, ICSASG_v2, whole genome shotgun sequence.
taxonomy:"8030", bioproject:"PRJNA287919", refseq:"NC_027312.1"
NC_027312.1:79790748-79790762
GTTATTGTCTGAATTCTTATTATTTTAATT79790748TTCATTGACAACATTCACCTTTTTGAGGTCATCAGAGACATTACT
Salmo salar isolate Sally breed double haploid chromosome ssa16, ICSASG_v2, whole genome shotgun sequence.
taxonomy:"8030", bioproject:"PRJNA287919", refseq:"NC_027315.1"
NC_027315.1:60914351-60914365
CCCTCGCCCTGTTCCTTAGGGCCTGACAGG60914351TTCATTGACAACATTAAGCACATGATTGGCTACAGCCCGCTGCCC
Salmo salar isolate Sally breed double haploid chromosome ssa19, ICSASG_v2, whole genome shotgun sequence.
taxonomy:"8030", bioproject:"PRJNA287919", refseq:"NC_027318.1"
NC_027318.1:51961393-51961407
GACCATAGTCCCCCCTCAGTGCTTTATTTC51961393TTCATTGACAACATTGATTCATTGTTAGCATCTTAGCTAATCGCT
Salmo salar isolate Sally breed double haploid chromosome ssa21, ICSASG_v2, whole genome shotgun sequence.
taxonomy:"8030", bioproject:"PRJNA287919", refseq:"NC_027320.1"
NC_027320.1:21214713-21214727
CCACCAGAGCTGTTGACAGAGAATGTAATG21214713TTCATTGACAACATTCCACAGGCCACAATCAACAGCCTGATAAAC
Salmo trutta chromosome 2, fSalTru1.1, whole genome shotgun sequence.
taxonomy:"8032", bioproject:"PRJNA550988", refseq:"NC_042958.1"
NC_042958.1:36749265-36749279
CAATAGGGACGGGTATAAAGGCAACCTAAT36749265TTCATTGACAACATTGTACATAAAACACCGCTACAGTGCTGCTCT
Salmo trutta chromosome 2, fSalTru1.1, whole genome shotgun sequence.
taxonomy:"8032", bioproject:"PRJNA550988", refseq:"NC_042958.1"
NC_042958.1:59473295-59473309
AGACCATAGTCCCCCTCAGTACTTTATTTC59473295TTCATTGACAACATTGATTCATTGTTAGCATCTTAGCTAATCGCT
Salmo trutta chromosome 13, fSalTru1.1, whole genome shotgun sequence.
taxonomy:"8032", bioproject:"PRJNA550988", refseq:"NC_042969.1"
NC_042969.1:76112386-76112400
AATCTGACTCTGGAGAAGTAGAAACAGGGC76112386TTCATTGACAACATTCAAAGTATTCCTTTAAGCATACCAGACAGC
Salmo trutta chromosome 14, fSalTru1.1, whole genome shotgun sequence.
taxonomy:"8032", bioproject:"PRJNA550988", refseq:"NC_042970.1"
NC_042970.1:66202399-66202413
CGTGTTAAAAAAATTATAATATTGACAAGC66202399TTCATTGACAACATTCTAAACAGATATCATATCTGTATGAATTGA
Salmo trutta chromosome 14, fSalTru1.1, whole genome shotgun sequence.
taxonomy:"8032", bioproject:"PRJNA550988", refseq:"NC_042970.1"
NC_042970.1:66223625-66223639
GTGTTTAAAAAAATATATATATTAACAAGC66223625TTCATTGACAACATTCTAAATGGATAGCATATCTGTATGAATTGA
Salmo trutta chromosome 15, fSalTru1.1, whole genome shotgun sequence.
taxonomy:"8032", bioproject:"PRJNA550988", refseq:"NC_042971.1"
NC_042971.1:40291294-40291308
GTTATTGTCTGAATTCTTATTATTTCAATT40291294TTCATTGACAACATTCACCTTTTTGAGGTCATCAGAGACATTACT
Salmo trutta chromosome 29, fSalTru1.1, whole genome shotgun sequence.
taxonomy:"8032", bioproject:"PRJNA550988", refseq:"NC_042985.1"
NC_042985.1:27477801-27477815
TAATAACTCAGCTAGTGCTGACAGCTCTTG27477801TTCATTGACAACATTGTACGCTGAGAGCATAAGAAGCATTTATGA
Salmo trutta chromosome 35, fSalTru1.1, whole genome shotgun sequence.
taxonomy:"8032", bioproject:"PRJNA550988", refseq:"NC_042991.1"
NC_042991.1:28089045-28089059
AAAGATATTGGAAACTACTTTAATTATTTT28089045TTCATTGACAACATTAGCATGCCAGGCAACAAACACTGACACTAC
Salvelinus alpinus isolate IW2-2015 linkage group LG1, ASM291031v2, whole genome shotgun sequence.
taxonomy:"8036", bioproject:"PRJNA433373", refseq:"NC_036838.1"
NC_036838.1:21796159-21796173
ACACATAATTTATTTGTGAATGATTCTTCA21796159TTCATTGACAACATTTTTGGCAGTAAGCTATCTCCATAATATATG
Salvelinus alpinus isolate IW2-2015 linkage group LG6.2, ASM291031v2, whole genome shotgun sequence.
taxonomy:"8036", bioproject:"PRJNA433373", refseq:"NC_036846.1"
NC_036846.1:11364565-11364579
GTGCTATATTTCTTCAATAATAACTACTAT11364565TTCATTGACAACATTATTCCAGCCATTATCTTGTCTTTAATAATG
Salvelinus alpinus isolate IW2-2015 linkage group LG6.2, ASM291031v2, whole genome shotgun sequence.
taxonomy:"8036", bioproject:"PRJNA433373", refseq:"NC_036846.1"
NC_036846.1:17471092-17471106
TTGAGTACCAAATARAGACAAAGTTCGCTG17471092TTCATTGACAACATTTTAGGTAAGAGCTTTCCATTTATATATAGA
Gallus gallus breed Red Jungle Fowl isolate RJF #256 chromosome 14, GRCg6a.
taxonomy:"9031", bioproject:"PRJNA10808", refseq:"NC_006101.5"
NC_006101.5:14955359-14955373
AAGAGGGGGTGGTGAGAGAGGAAGCTGTGC14955359TTCATTGACAACATTCCTTGATGTTGTTGCCACTGGTAGAGTGGA
Gallus gallus breed Red Jungle Fowl isolate RJF #256 chromosome 21, GRCg6a.
taxonomy:"9031", bioproject:"PRJNA10808", refseq:"NC_006108.5"
NC_006108.5:757327-757341
TGCAGCAAATATTTTAAAGAAAACATGAAA757327TTCATTGACAACATTAATCAACAAATATTATTCAACTTATATTGG
Gallus gallus breed Red Jungle Fowl isolate RJF #256 chromosome Z, GRCg6a.
taxonomy:"9031", bioproject:"PRJNA10808", refseq:"NC_006127.5"
NC_006127.5:50073030-50073044
CATGATAACAATCTGTGTCATGTAATTGAG50073030TTCATTGACAACATTTAAGTAATCCATAGCTCGTTTCCATTGTTC
Camelina sativa cultivar DH55 chromosome 8, Cs, whole genome shotgun sequence.
taxonomy:"90675", bioproject:"PRJNA264159", refseq:"NC_025692.1"
NC_025692.1:23760099-23760113
CGTGATGCTGAAGGCCAAGATGTGTTGCTT23760099TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGTCTTGCTCTT
Camelina sativa cultivar DH55 chromosome 8, Cs, whole genome shotgun sequence.
taxonomy:"90675", bioproject:"PRJNA264159", refseq:"NC_025692.1"
NC_025692.1:23763955-23763969
CGTGATGCCGAAGGCCAAGATGTGTTGCTT23763955TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCCTTGTTATT
Camelina sativa cultivar DH55 chromosome 13, Cs, whole genome shotgun sequence.
taxonomy:"90675", bioproject:"PRJNA264159", refseq:"NC_025697.1"
NC_025697.1:3613229-3613243
CGTGATGCCGAAGGCCAAGATGTGTTGCTT3613229TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGTCTTGCTCTT
Camelina sativa cultivar DH55 chromosome 13, Cs, whole genome shotgun sequence.
taxonomy:"90675", bioproject:"PRJNA264159", refseq:"NC_025697.1"
NC_025697.1:3618705-3618719
CGTGATGCCGAAGGCCAAGACGTGTTGCTT3618705TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCCTTGTTATT
Camelina sativa cultivar DH55 chromosome 20, Cs, whole genome shotgun sequence.
taxonomy:"90675", bioproject:"PRJNA264159", refseq:"NC_025704.1"
NC_025704.1:3717380-3717394
CGTGATGCCGAAGGCCAAGACGTGTTGCTT3717380TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCCTTATTATT
Meleagris gallopavo isolate NT-WF06-2002-E0010 breed Aviagen turkey brand Nicholas breeding stock chromosome 4, Turkey_5.1, whole genome shotgun sequence.
taxonomy:"9103", bioproject:"PRJNA62397", refseq:"NC_015014.2"
NC_015014.2:28814883-28814897
TTGGCACTGCTTGCTAAAAGCAGAAGTGAT28814883TTCATTGACAACATTATTTTGAAAGTGACATTCTGCCTGGAGAAT
Meleagris gallopavo isolate NT-WF06-2002-E0010 breed Aviagen turkey brand Nicholas breeding stock chromosome 4, Turkey_5.1, whole genome shotgun sequence.
taxonomy:"9103", bioproject:"PRJNA62397", refseq:"NC_015014.2"
NC_015014.2:61503832-61503846
GTTACATTCGTATTAATACTACTGTCTGAA61503832TTCATTGACAACATTATAAAACAGTACCTTTGAGACAGAAAAGAA
Meleagris gallopavo isolate NT-WF06-2002-E0010 breed Aviagen turkey brand Nicholas breeding stock chromosome 9, Turkey_5.1, whole genome shotgun sequence.
taxonomy:"9103", bioproject:"PRJNA62397", refseq:"NC_015019.2"
NC_015019.2:14207471-14207485
TAGCTGCTCATTAGAGACTGATACACCTTA14207471TTCATTGACAACATTTGTTGCTGAGTGTTTTAATGTTGTTCAACA
Meleagris gallopavo isolate NT-WF06-2002-E0010 breed Aviagen turkey brand Nicholas breeding stock chromosome Z, Turkey_5.1, whole genome shotgun sequence.
taxonomy:"9103", bioproject:"PRJNA62397", refseq:"NC_015041.2"
NC_015041.2:44410669-44410683
CATGATAACAATCTGTGTCATGTAATTGAG44410669TTCATTGACAACATTTAAGTAATCCATAGCTCGTTTCCATTGTTC
Parus major isolate Abel chromosome 2, Parus_major1.1, whole genome shotgun sequence.
taxonomy:"9157", bioproject:"PRJNA312399", refseq:"NC_031769.1"
NC_031769.1:141973436-141973450
CCTCCAAAATCCTCCTTCTATACCAGTTTC141973436TTCATTGACAACATTGAGATAACCACAGTCTTTTTCCATTGTCAC
Parus major isolate Abel chromosome 3, Parus_major1.1, whole genome shotgun sequence.
taxonomy:"9157", bioproject:"PRJNA312399", refseq:"NC_031770.1"
NC_031770.1:19934595-19934609
GAAAACAGAAGTCTTCATTTTGCAAGGTGT19934595TTCATTGACAACATTCCAGCAGGCTAAAATAGTAACAGGAGGAAT
Parus major isolate Abel chromosome Z, Parus_major1.1, whole genome shotgun sequence.
taxonomy:"9157", bioproject:"PRJNA312399", refseq:"NC_031799.1"
NC_031799.1:13908452-13908466
CAATAGTCAGAGAATACAAAATGGCTGTCA13908452TTCATTGACAACATTATCATCAGGCAGCATTACAGATTTTTTTCT
Parus major isolate Abel chromosome Z, Parus_major1.1, whole genome shotgun sequence.
taxonomy:"9157", bioproject:"PRJNA312399", refseq:"NC_031799.1"
NC_031799.1:24973098-24973112
TTAAGCTTTTATTTCTTTTTTTTTAATCAG24973098TTCATTGACAACATTTCTTCACGAGAAGAAGTGGATCAAGCCGAA
Parus major isolate Abel chromosome Z, Parus_major1.1, whole genome shotgun sequence.
taxonomy:"9157", bioproject:"PRJNA312399", refseq:"NC_031799.1"
NC_031799.1:27152293-27152307
AATACAAAGTGAACAAATAAGGATGTAATT27152293TTCATTGACAACATTCTAGAATTTAAAAACACAAACATTCCCACA
Catharus ustulatus isolate bCatUst1 chromosome 1, bCatUst1.pri, whole genome shotgun sequence.
taxonomy:"91951", bioproject:"PRJNA613294", refseq:"NC_046221.1"
NC_046221.1:153896352-153896366
ATTTCTGCAAAATCCTCCTATGGTAGTTGC153896352TTCATTGACAACATTTTGAGATAACCACAGTCTTTTTCCATTGTC
Catharus ustulatus isolate bCatUst1 chromosome 1, bCatUst1.pri, whole genome shotgun sequence.
taxonomy:"91951", bioproject:"PRJNA613294", refseq:"NC_046221.1"
NC_046221.1:154294911-154294925
ATTTCTGCAAAATCCTCCTATGGTAGTTGC154294911TTCATTGACAACATTTTGAGATAACCACAGTCTTTTTCCATTGTC
Catharus ustulatus isolate bCatUst1 chromosome 3, bCatUst1.pri, whole genome shotgun sequence.
taxonomy:"91951", bioproject:"PRJNA613294", refseq:"NC_046223.1"
NC_046223.1:22205271-22205285
GAAAACAGAAGTCTTCATTTTGCAAGGTGT22205271TTCATTGACAACATTCCAGAAGACTGGAATAGGAACAGAAGGAAT
Calypte anna isolate BGI_N300 chromosome 3, bCalAnn1_v1.p, whole genome shotgun sequence.
taxonomy:"9244", bioproject:"PRJNA558503", refseq:"NC_044246.1"
NC_044246.1:61887663-61887677
GATAAGATCTCGCATTTGTAGAAACCAAAC61887663TTCATTGACAACATTGCTTGTTAAAGAGAGGGGGATGAAGAACAG
Calypte anna isolate BGI_N300 chromosome 6, bCalAnn1_v1.p, whole genome shotgun sequence.
taxonomy:"9244", bioproject:"PRJNA558503", refseq:"NC_044252.1"
NC_044252.1:11810257-11810271
TTGTCATATTTCAGTATATTTCTCCAACCT11810257TTCATTGACAACATTAGACAAAATCTATTACCACCACTCACAACA
Calypte anna isolate BGI_N300 chromosome 9, bCalAnn1_v1.p, whole genome shotgun sequence.
taxonomy:"9244", bioproject:"PRJNA558503", refseq:"NC_044255.1"
NC_044255.1:10096385-10096399
TCACTATAGCTAACAAGTGACTCTTCTCCT10096385TTCATTGACAACATTGTACTTGTCAAGCAAAAATCAAGTCAATAG
Calypte anna isolate BGI_N300 chromosome 20, bCalAnn1_v1.p, whole genome shotgun sequence.
taxonomy:"9244", bioproject:"PRJNA558503", refseq:"NC_044265.1"
NC_044265.1:11707122-11707136
ATACTATTATTTTTTTTTAATTAATTGTTC11707122TTCATTGACAACATTTACAAAGTCCTTTCCCCTCACTGCTGACAC
Calypte anna isolate BGI_N300 chromosome 22, bCalAnn1_v1.p, whole genome shotgun sequence.
taxonomy:"9244", bioproject:"PRJNA558503", refseq:"NC_044267.1"
NC_044267.1:1782070-1782084
ACTTTTTCTTGCAATTTTCCAGTGATGTTT1782070TTCATTGACAACATTCTCTGGGCTGTAATTGCTTAAGCAGCTTAA
Calypte anna isolate BGI_N300 chromosome Z, bCalAnn1_v1.p, whole genome shotgun sequence.
taxonomy:"9244", bioproject:"PRJNA558503", refseq:"NC_044274.1"
NC_044274.1:28730367-28730381
CATGATAACAATCTGTGTCATGTAATTGAG28730367TTCATTGACAACATTTAAATAATCCATAGCTCGTTTCCACTGTTC
Ornithorhynchus anatinus isolate Pmale09 chromosome 1, mOrnAna1.p.v1, whole genome shotgun sequence.
taxonomy:"9258", bioproject:"PRJNA534073", refseq:"NC_041728.1"
NC_041728.1:121096370-121096384
CCACAAATATACAAACCATGTGTGCCATGA121096370TTCATTGACAACATTCCCCTTACAAAAATAAGTTTGGAATAAAAG
Ornithorhynchus anatinus isolate Pmale09 chromosome 4, mOrnAna1.p.v1, whole genome shotgun sequence.
taxonomy:"9258", bioproject:"PRJNA534073", refseq:"NC_041731.1"
NC_041731.1:14693963-14693977
ATGGAGTTGGTGGTGGTAACACCAGTGTAG14693963TTCATTGACAACATTCTCCCATTCAGTTACCTCTTATCTTTTTTT
Sarcophilus harrisii chromosome 1, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045426.1"
NC_045426.1:210081639-210081653
CATGATAACAATTTGAGTCATGTAATTGAG210081639TTCATTGACAACATTTAGATAATCCATAGCACGCTTCCACTGATC
Sarcophilus harrisii chromosome 1, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045426.1"
NC_045426.1:266868615-266868629
GTTCTATCCAAATTTACCTACTTATTACTC266868615TTCATTGACAACATTTTCTTTCCCATCTCATTGCTTTTGCACAGG
Sarcophilus harrisii chromosome 1, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045426.1"
NC_045426.1:351600817-351600831
GGAAAAACAAAGCAACTTTTCCTATGTCTC351600817TTCATTGACAACATTGTTTACTATTAAAGAATAAACAAGATCAGG
Sarcophilus harrisii chromosome 1, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045426.1"
NC_045426.1:355007507-355007521
ACATTGGCCTTCTTGTTACTCTTCATGTTT355007507TTCATTGACAACATTATATCTTCTGATTACCTGATCATATACCTG
Sarcophilus harrisii chromosome 1, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045426.1"
NC_045426.1:636049531-636049545
GTATTGTTATATAAAGTCTTCTTCTGTAGG636049531TTCATTGACAACATTTTTGTAGCAAATCTAGCAGTAGAGAAAACA
Sarcophilus harrisii chromosome 2, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045427.1"
NC_045427.1:172002722-172002736
AAAATGTCAACAAACAAAAGCCATGTACTA172002722TTCATTGACAACATTACAGTATAGACTTCCTTCTTTCTATATAGT
Sarcophilus harrisii chromosome 2, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045427.1"
NC_045427.1:329864152-329864166
TCTATCTAGTTTCTGGACTGCTTTTCAGTT329864152TTCATTGACAACATTTTCTTTTCTTTTCTTCTTTTTTTTTCTGAG
Sarcophilus harrisii chromosome 2, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045427.1"
NC_045427.1:444767350-444767364
AAGTTTGACTAGATGACTTCTGAGGTCCAT444767350TTCATTGACAACATTCTATGTTCTATGTTCTTTCATTCTGAATTC
Sarcophilus harrisii chromosome 3, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045428.1"
NC_045428.1:101681680-101681694
GATATGTTTGTATTTAGCCTGAGAAGATAG101681680TTCATTGACAACATTTGGAATTTCCCTAATCTTATATGTAAGTGA
Sarcophilus harrisii chromosome 3, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045428.1"
NC_045428.1:363283900-363283914
GTTCCATAAAGGAAGATTAATTTACTTTAC363283900TTCATTGACAACATTGGTGAAAATCTTCCTTTTCACCAGTGTTGT
Sarcophilus harrisii chromosome 3, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045428.1"
NC_045428.1:367694303-367694317
TTAATTAACTTAAAAACATGATTTTGATAG367694303TTCATTGACAACATTAGACTTACAAAGCAATCCATTGCACACAGA
Sarcophilus harrisii chromosome 4, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045429.1"
NC_045429.1:438018990-438019004
TCCTCGGTGAAGTACGACTCAGAGAAGCAC438018990TTCATTGACAACATTTACATGCCGGTGGGGCTGGCGGTCTCCTCC
Sarcophilus harrisii chromosome 5, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045430.1"
NC_045430.1:205857786-205857800
CACCAGCATCCGCATCGGATTACTAACTTT205857786TTCATTGACAACATTTTGCGGCCAGAGTTCGGCCGAAGAAAGGAA
Sarcophilus harrisii chromosome 5, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045430.1"
NC_045430.1:238363333-238363347
AAGCTACAGGGAAATGAAGAAGGCTGAAGA238363333TTCATTGACAACATTGGAAAGAGCAGTTTTAGTTGAATGTTAAGA
Sarcophilus harrisii chromosome 6, mSarHar1.11, whole genome shotgun sequence.
taxonomy:"9305", bioproject:"PRJNA596784", refseq:"NC_045431.1"
NC_045431.1:45383023-45383037
TATATGCATACAAATACTTAATGAAGAATA45383023TTCATTGACAACATTTTATAGTAATTTTAAGAAGTCACATTTAAA
Staphylococcus pseudintermedius HKU10-03, complete sequence.
taxonomy:"937773", bioproject:"PRJNA224116", refseq:"NC_014925.1"
NC_014925.1:2478572-2478586
TACTGGTCCTGAGTTCGTCTCCATTTTAAG2478572TTCATTGACAACATTAATCGTTGCTGTTGTAACTGCGCGTAAAGG
Coturnix japonica isolate 7356 chromosome 2, Coturnix japonica 2.1, whole genome shotgun sequence.
taxonomy:"93934", bioproject:"PRJNA314147", refseq:"NC_029517.1"
NC_029517.1:62968666-62968680
GACTTCCTTTCAAAAAGTTCGTGTTAGTTT62968666TTCATTGACAACATTTGCTATCTGATTGCAGGGAACAGAGAATGC
Callithrix jacchus chromosome 4, Callithrix jacchus-3.2, whole genome shotgun sequence.
taxonomy:"9483", bioproject:"PRJNA46205", refseq:"NC_013899.1"
NC_013899.1:83483837-83483851
TGTCTCATTTGAAGTTTGTTTTTACTTGAA83483837TTCATTGACAACATTATACAATCTGAAAACTACATAAAACCTAAA
Callithrix jacchus chromosome 7, Callithrix jacchus-3.2, whole genome shotgun sequence.
taxonomy:"9483", bioproject:"PRJNA46205", refseq:"NC_013902.1"
NC_013902.1:49423688-49423702
TCACTCACCAGGAGGCTGCTGAGAAAACAG49423688TTCATTGACAACATTGCCCATGAAGATGCCAACTCGAGTCTCATT
Callithrix jacchus chromosome 10, Callithrix jacchus-3.2, whole genome shotgun sequence.
taxonomy:"9483", bioproject:"PRJNA46205", refseq:"NC_013905.1"
NC_013905.1:49868671-49868685
CAGAAATTTTGGAAATGCTACTGTTGCTTT49868671TTCATTGACAACATTAGCTGGGACTGTATTAAATATCAAATATAT
Macaca fascicularis chromosome 5, Macaca_fascicularis_5.0, whole genome shotgun sequence.
taxonomy:"9541", bioproject:"PRJNA215851", refseq:"NC_022276.1"
NC_022276.1:148104515-148104529
CAGAATATATTATCGCTTTGAACACAGATT148104515TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
Macaca fascicularis chromosome 5, Macaca_fascicularis_5.0, whole genome shotgun sequence.
taxonomy:"9541", bioproject:"PRJNA215851", refseq:"NC_022276.1"
NC_022276.1:165086432-165086446
TAAAACCTCTGATTTTGTGTAACACTCCTT165086432TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTACAT
Pongo abelii isolate Susie chromosome 2B, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036905.1"
NC_036905.1:46295897-46295911
ATTGCAGCAAAGAAGCACATTTATATTCTA46295897TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
Pongo abelii isolate Susie chromosome 3, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036906.1"
NC_036906.1:84593114-84593128
ACTATGCTGCACTCCAAATACTATTGTATT84593114TTCATTGACAACATTCCCTATTACATATGCATGTGAAAAACAGGC
Pongo abelii isolate Susie chromosome 3, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036906.1"
NC_036906.1:90725632-90725646
TGGATATCTTATATGCCTTTGGAAGTTTAT90725632TTCATTGACAACATTTTTCCAGCTCCCATTTACACCACTTAACAA
Pongo abelii isolate Susie chromosome 4, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036907.1"
NC_036907.1:147708824-147708838
CAGAATGTATTATCGCTTTAAACACAGATT147708824TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
Pongo abelii isolate Susie chromosome 4, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036907.1"
NC_036907.1:164818774-164818788
AAAAATCTCTGATTTTGTGTAACACTCCTT164818774TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTATAT
Pongo abelii isolate Susie chromosome 4, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036907.1"
NC_036907.1:180824497-180824511
TTTGGACCCCCAAATCAGTCTTCATATTCT180824497TTCATTGACAACATTCATTAAGTTCTGCAGAAATTAAATAGAATT
Pongo abelii isolate Susie chromosome 6, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036909.1"
NC_036909.1:25117798-25117812
TAGTTAACTAGCTCTTTGAGCCTTAGTTTT25117798TTCATTGACAACATTAAGATAACAAAATCTTTGTATCTTAAAAGA
Pongo abelii isolate Susie chromosome 8, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036911.1"
NC_036911.1:17416378-17416392
CCCATTAGGTACAAACTTTTCATTTCTGTG17416378TTCATTGACAACATTAAAATTATTACACGTCAGTTTCAATACATA
Pongo abelii isolate Susie chromosome 8, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036911.1"
NC_036911.1:30482406-30482420
ATATTTTTAAATTCATCCATATTTCCACTT30482406TTCATTGACAACATTATTAAGTTTTTTTGTGTCTGTTTTTTCAAA
Pongo abelii isolate Susie chromosome 9, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036912.1"
NC_036912.1:8732957-8732971
ACCTAAATATACAATTAAAGCTCAATCTAC8732957TTCATTGACAACATTGAGAAGGGCTAAGAACCTCTATATACTCAA
Pongo abelii isolate Susie chromosome 10, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036913.1"
NC_036913.1:130578299-130578313
TCTTCAAATATTTTACAGAGTTTGACTCTT130578299TTCATTGACAACATTAATGCCTCAAAAGAAAGAAAAAGGCCAGGC
Pongo abelii isolate Susie chromosome 13, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036916.1"
NC_036916.1:67972315-67972329
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA67972315TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
Pongo abelii isolate Susie chromosome 18, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036921.1"
NC_036921.1:24220436-24220450
ATATTTATATATGTATGTATTTCATATTAT24220436TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
Pongo abelii isolate Susie chromosome 19, Susie_PABv2, whole genome shotgun sequence.
taxonomy:"9601", bioproject:"PRJNA37793", refseq:"NC_036922.1"
NC_036922.1:39049440-39049454
GAGCCACCACGCCTGGCCTATCTTAGCTTT39049440TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Homo sapiens chromosome 1, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000001.11"
NC_000001.11:82996793-82996807
CTAATTAATGAATAGTAAGTATATTTTCTC82996793TTCATTGACAACATTTTTCCTCTTACTTTATTGTAAGAATACAAT
Homo sapiens chromosome 2, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000002.12"
NC_000002.12:160366604-160366618
ATTGCAGCAAAGAAGCACATTTATATTCTA160366604TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
Homo sapiens chromosome 3, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000003.12"
NC_000003.12:15248283-15248297
ATTGTAATAGCCAGAAATTGGAAACATATA15248283TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Homo sapiens chromosome 3, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000003.12"
NC_000003.12:84570694-84570708
TTGGTTTTGTATATATTAAATAGTTGAAAC84570694TTCATTGACAACATTAAGTTTGTTTTCTAGGCTCTATTGGGATAA
Homo sapiens chromosome 4, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000004.12"
NC_000004.12:16133028-16133042
AACGAAAGGCGTTTGAGGAAAGCCTGATAA16133028TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
Homo sapiens chromosome 4, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000004.12"
NC_000004.12:62165422-62165436
TCTTCAAATATTTTACAGAGTTCAACTCTT62165422TTCATTGACAACATTATGACATTATGCTGATTGGATCCAGTGAGT
Homo sapiens chromosome 4, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000004.12"
NC_000004.12:148912066-148912080
CAGAATATATTATCGCTTTAAACACAGATT148912066TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
Homo sapiens chromosome 4, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000004.12"
NC_000004.12:165800998-165801012
AAAAACGTCTGATTTTGTGTAACACTCCTT165800998TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
Homo sapiens chromosome 6, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000006.12"
NC_000006.12:61998311-61998325
CTATTTCAATCAACCATCTTGTAATCATAC61998311TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
Homo sapiens chromosome 7, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000007.14"
NC_000007.14:3524041-3524055
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC3524041TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000008.11"
NC_000008.11:31498629-31498643
GTATTTTTAAATTCATCGATATTTCCACTT31498629TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Homo sapiens chromosome 11, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000011.10"
NC_000011.10:24472484-24472498
TTGAGTTTCCTGGAACATAGATATGTCTTG24472484TTCATTGACAACATTCTAGCATTGAGGACAGTGAATAGAGAAAAG
Homo sapiens chromosome 13, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000013.11"
NC_000013.11:84191412-84191426
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA84191412TTCATTGACAACATTTCCTGAGGTAACTCACACTGAGGTGACAAC
Homo sapiens chromosome 18, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000018.10"
NC_000018.10:29571724-29571738
ATATTTATATATGTATATATTTCATATTAT29571724TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
Homo sapiens chromosome 19, GRCh38.p13 Primary Assembly.
taxonomy:"9606", bioproject:"PRJNA168", refseq:"NC_000019.10"
NC_000019.10:41061361-41061375
AAGCCACCACACCCGGCCTATCTTAGCTTT41061361TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Canis lupus familiaris breed boxer chromosome 2, CanFam3.1, whole genome shotgun sequence.
taxonomy:"9615", bioproject:"PRJNA12384", refseq:"NC_006584.3"
NC_006584.3:31059729-31059743
ATAATCAAAAATAACACTGCAACAGTGCAG31059729TTCATTGACAACATTTGCTTTCCAATCGTGCCAACTAAGAAAAAA
Canis lupus familiaris breed boxer chromosome 3, CanFam3.1, whole genome shotgun sequence.
taxonomy:"9615", bioproject:"PRJNA12384", refseq:"NC_006585.3"
NC_006585.3:8039506-8039520
CATGATCACAATCTGAGTCATGTAATTGAG8039506TTCATTGACAACATTTAAGTAATCCATAGCTCGTTTCCACTGTTC
Canis lupus familiaris breed boxer chromosome 4, CanFam3.1, whole genome shotgun sequence.
taxonomy:"9615", bioproject:"PRJNA12384", refseq:"NC_006586.3"
NC_006586.3:18669159-18669173
AATAAATTGAAAAGGACAAAGAGAATTTCA18669159TTCATTGACAACATTTTGTAAAATTATTTTATTTATTTATTTTAC
Canis lupus familiaris breed boxer chromosome 5, CanFam3.1, whole genome shotgun sequence.
taxonomy:"9615", bioproject:"PRJNA12384", refseq:"NC_006587.3"
NC_006587.3:77585856-77585870
AACTATGATTTTTTCCTTTGAAATCTATTT77585856TTCATTGACAACATTTATCCCTTATCTTCTCTCTCCAATTGTGAG
Canis lupus familiaris breed boxer chromosome 12, CanFam3.1, whole genome shotgun sequence.
taxonomy:"9615", bioproject:"PRJNA12384", refseq:"NC_006594.3"
NC_006594.3:36189504-36189518
ATTGAGGCCAGAGCTCCGTCCTGAATTAGG36189504TTCATTGACAACATTCCCTTACCACACTCTTTCTCAGACTTTAAG
Canis lupus familiaris breed boxer chromosome 15, CanFam3.1, whole genome shotgun sequence.
taxonomy:"9615", bioproject:"PRJNA12384", refseq:"NC_006597.3"
NC_006597.3:47120580-47120594
TAGAATATATTATCACTTTAAACACAGATT47120580TTCATTGACAACATTCTGTGGGCATCCATTTAATATTAATATTAA
Canis lupus familiaris breed boxer chromosome 20, CanFam3.1, whole genome shotgun sequence.
taxonomy:"9615", bioproject:"PRJNA12384", refseq:"NC_006602.3"
NC_006602.3:25899526-25899540
AGTCGACAACAAAAGCACTATCTGTGTTGT25899526TTCATTGACAACATTTCTGAAGTGGCCATTTATCTCTCACAGCAA
Canis lupus familiaris breed boxer chromosome 33, CanFam3.1, whole genome shotgun sequence.
taxonomy:"9615", bioproject:"PRJNA12384", refseq:"NC_006615.3"
NC_006615.3:24673054-24673068
TTCTGAGAATTTAATGGAAAACATGATGAC24673054TTCATTGACAACATTGCAATGTATAATTGAAATTTGCTAAGAGAG
Felis catus isolate Cinnamon breed Abyssinian chromosome B2, Felis_catus_9.0, whole genome shotgun sequence.
taxonomy:"9685", bioproject:"PRJNA175699", refseq:"NC_018727.3"
NC_018727.3:69872322-69872336
GTTGGGGCCAGAGTTCCATCCAGAATTAAG69872322TTCATTGACAACATTCCCCTCACCACTCACTCTTTCCCAGACTTT
Physeter catodon isolate SW-GA chromosome 1, ASM283717v2, whole genome shotgun sequence.
taxonomy:"9755", bioproject:"PRJNA434122", refseq:"NC_041214.1"
NC_041214.1:84857981-84857995
CTCTTTAATTTGTAACCAAATTAAAATTAA84857981TTCATTGACAACATTACTCCTTTGCCTAGATAGGGCTAAGTGGGA
Physeter catodon isolate SW-GA chromosome 4, ASM283717v2, whole genome shotgun sequence.
taxonomy:"9755", bioproject:"PRJNA434122", refseq:"NC_041217.1"
NC_041217.1:120403191-120403205
AACAGTTCACAAAGGTTTTCTTTTCTCCAC120403191TTCATTGACAACATTTGTTATTTCTTGTCTTTTTGATAATAGCTG
Physeter catodon isolate SW-GA chromosome 6, ASM283717v2, whole genome shotgun sequence.
taxonomy:"9755", bioproject:"PRJNA434122", refseq:"NC_041219.1"
NC_041219.1:44975357-44975371
AACCCCTGGCACCCCGTGACAACTACTTCA44975357TTCATTGACAACATTCATGACAACAACAACATTCATTTCAGAATG
Physeter catodon isolate SW-GA chromosome 7, ASM283717v2, whole genome shotgun sequence.
taxonomy:"9755", bioproject:"PRJNA434122", refseq:"NC_041220.1"
NC_041220.1:30992584-30992598
CTAGAATATATTATCGCTTAAACACAGATT30992584TTCATTGACAACATTCTGTGGGCATTCATTTAATATTAATATCAA
Physeter catodon isolate SW-GA chromosome 7, ASM283717v2, whole genome shotgun sequence.
taxonomy:"9755", bioproject:"PRJNA434122", refseq:"NC_041220.1"
NC_041220.1:88142149-88142163
AAGTAAAGGGATGAATGTAGGCTCAAACTC88142149TTCATTGACAACATTATTTAGGATACCACAATAAATCTAATGGAT
Physeter catodon isolate SW-GA chromosome 8, ASM283717v2, whole genome shotgun sequence.
taxonomy:"9755", bioproject:"PRJNA434122", refseq:"NC_041221.1"
NC_041221.1:95585904-95585918
GAAACAAAGGTCAGAGTTTAAGGAAATCAC95585904TTCATTGACAACATTCAATATTTACTAAATTTCAACTTTATCCTG
Physeter catodon isolate SW-GA chromosome 13, ASM283717v2, whole genome shotgun sequence.
taxonomy:"9755", bioproject:"PRJNA434122", refseq:"NC_041226.1"
NC_041226.1:45161834-45161848
TACTTCATACTGATTTTCTTATGCCCTCTG45161834TTCATTGACAACATTGAGATCCCTCAAATCCAACTTTATTCCTGG
Physeter catodon isolate SW-GA chromosome 15, ASM283717v2, whole genome shotgun sequence.
taxonomy:"9755", bioproject:"PRJNA434122", refseq:"NC_041228.1"
NC_041228.1:15146242-15146256
TGATGTTACCGTGGTTGTTGTTTTATCTAA15146242TTCATTGACAACATTTAAGATTTCCAACTTCTCTTGACCCCAGAG
Physeter catodon isolate SW-GA chromosome 18, ASM283717v2, whole genome shotgun sequence.
taxonomy:"9755", bioproject:"PRJNA434122", refseq:"NC_041231.1"
NC_041231.1:36616422-36616436
AGTATGCTGCACTCCAAATACTATTGTGTT36616422TTCATTGACAACATTCACTATTACATATGCATGTGAAAAACAGGC
Physeter catodon isolate SW-GA chromosome 20, ASM283717v2, whole genome shotgun sequence.
taxonomy:"9755", bioproject:"PRJNA434122", refseq:"NC_041233.1"
NC_041233.1:11990944-11990958
CAATAATGTATCTTATAATATTCTAAGATA11990944TTCATTGACAACATTTTTAAATGCTCATATTTTTGCACTGATCTC
Quercus lobata isolate SW786 chromosome 1, ValleyOak3.0 Primary Assembly, whole genome shotgun sequence.
taxonomy:"97700", bioproject:"PRJNA574457", refseq:"NC_044904.1"
NC_044904.1:20624267-20624281
GTTGCCAAAGCCAACGCTACCAACTTTACC20624267TTCATTGACAACATTGCCAAAGCCAATGCTACCACCTTTGCTGCC
Quercus lobata isolate SW786 chromosome 1, ValleyOak3.0 Primary Assembly, whole genome shotgun sequence.
taxonomy:"97700", bioproject:"PRJNA574457", refseq:"NC_044904.1"
NC_044904.1:21262356-21262370
CTTAAGGAAGAATAAGATCACATGAACTAA21262356TTCATTGACAACATTACACATTTGCATTATGTTTGCATTTCAACC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/togogenome200/TTCATTGACAACATT
lang : en | db : togogenome200 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.113 | 0.105 | search_plus_done; http://172.18.8.71:27900/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.347 | 0.234 | search_minus_done; http://172.18.8.71:27900/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.347 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).