GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 09:22:23, GGGenome : Oryza glaberrima genome, AGI1.1 (May, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

7 dna:chromosome chromosome:AGI1.1:7:1:21799424:1
position: 17290082-17290096
AGATCTATCTAATTTAGGTGTAGTGCTCTC17290082TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
9 dna:chromosome chromosome:AGI1.1:9:1:17607432:1
position: 11800486-11800500
CTTTCAAATGATGGTCAAACTAATTATAAA11800486TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
10 dna:chromosome chromosome:AGI1.1:10:1:16910673:1
position: 2051397-2051411
ACAGATATATTCACAATATTGGTTCACAGG2051397TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
5 dna:chromosome chromosome:AGI1.1:5:1:23192814:1
position: 6141713-6141727
TATGATTAAGCACCCCTACCTACTTTGCAA6141713AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
5 dna:chromosome chromosome:AGI1.1:5:1:23192814:1
position: 21159038-21159052
TCTTGCATAAATTACCTGAGTGAAACGGAA21159038AATGTTGTCAATGAACAAAAGCACATCTTGTCCTTCGGCATCACG
10 dna:chromosome chromosome:AGI1.1:10:1:16910673:1
position: 3704433-3704447
CCTCCATAAGCAATGCCTCTTTTCCCTATC3704433AATGTTGTCAATGAATGTTTTAGGCAGCTGCAAAGTGCACATGTA
11 dna:chromosome chromosome:AGI1.1:11:1:20796451:1
position: 4183552-4183566
GCTAGAATAACTAAATAAATCACATGGTTA4183552AATGTTGTCAATGAAATATAACTTATATGTTGTGAAAAAAAAAAA
ADWL01012888.1 dna:scaffold scaffold:AGI1.1:ADWL01012888.1:1:2196:1
position: 1431-1445
GCTATCTTCAATGAATATAGTCCCTTCTGG1431AATGTTGTCAATGAATACCGTATTGTTAGCTGGAACAGTTCCTAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/AGI1.1/TTCATTGACAACATT
lang : en | db : AGI1.1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.078 | 0.070 | search_plus_done; http://172.18.8.75:28183/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.006 | search_minus_done; http://172.18.8.75:28183/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.087 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).