GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 01:27:32, GGGenome : Zea mays genome, AGPv4 (Mar, 2016)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

2 dna:chromosome chromosome:AGPv4:2:1:244442276:1 REF
position: 15453019-15453033
CTTCCTTTTAGAAACAGGTCTACGCGAACT15453019TTCATTGACAACATTTGCATATATATATATATATATATATTCATT
2 dna:chromosome chromosome:AGPv4:2:1:244442276:1 REF
position: 89092213-89092227
ATGCCCGAGTTGGATAAATTTGTGGTGGTC89092213TTCATTGACAACATTTTGATCTATTCCAAAAATGAAGAGGAGCAT
2 dna:chromosome chromosome:AGPv4:2:1:244442276:1 REF
position: 129343892-129343906
ATGCCAGAGCTGGACAAGTTTGTGGTGGTT129343892TTCATTGACAACATTCTGGTTTATTCCAAAAATGAAGCTGAGCAT
2 dna:chromosome chromosome:AGPv4:2:1:244442276:1 REF
position: 133947487-133947501
ATGGAATATCTTGATAAGTTTGTTGTGGTA133947487TTCATTGACAACATTCTGATCTATTCCAAAAATGATGGAGAAAAT
2 dna:chromosome chromosome:AGPv4:2:1:244442276:1 REF
position: 190513820-190513834
AGCATTTAAAGCATGATAAATTGTAGAAGG190513820TTCATTGACAACATTTCTCCTAGGCATATGAACAACATTTCTACC
3 dna:chromosome chromosome:AGPv4:3:1:235667834:1 REF
position: 91673310-91673324
ATGCCCGAGTTGGATAAATTTGTGGTGGTC91673310TTCATTGACAACATTCTGATCTATTCCAAAGATGAAGAGGAGCAT
3 dna:chromosome chromosome:AGPv4:3:1:235667834:1 REF
position: 197813387-197813401
CTCGACACCCCTGTCAATGTGAGGGAGGTC197813387TTCATTGACAACATTTCTCACATACATCATTATCGGGACAATATT
3 dna:chromosome chromosome:AGPv4:3:1:235667834:1 REF
position: 204015260-204015274
AGCATTTAAAGCATGATAAATTGTAGAAGG204015260TTCATTGACAACATTTCTCCTAGGCATATGAACAACATTTCTACC
4 dna:chromosome chromosome:AGPv4:4:1:246994605:1 REF
position: 52736322-52736336
TTTTTACTACACCAGTTGTAGATTGATCGA52736322TTCATTGACAACATTGGCTGTCATTGTAAAAGGGCAAAGCAGTAG
5 dna:chromosome chromosome:AGPv4:5:1:223902240:1 REF
position: 46250965-46250979
ATGGAAGAGCTGGATAAGTTTGTCGTAGTC46250965TTCATTGACAACATTCTTATCTACTCCAAGAACCGCGAAGACCAT
7 dna:chromosome chromosome:AGPv4:7:1:182381542:1 REF
position: 47409163-47409177
ATGGAAGAGTTAGATAAGTTTGTCGTAGTC47409163TTCATTGACAACATTCTCATCTACTCCAAGAGTCAACAGGAGCAT
7 dna:chromosome chromosome:AGPv4:7:1:182381542:1 REF
position: 128804475-128804489
CCTAATAGCAAATTCCGTGTTCCACATCAT128804475TTCATTGACAACATTCATCAACTCTTGAATGGAAGCCTTCTCTCT
10 dna:chromosome chromosome:AGPv4:10:1:150982314:1 REF
position: 31737153-31737167
TTCATCGAGCTGGATAAATTTGTGGTGGTT31737153TTCATTGACAACATTCTTATCTATTCCAAAAATGAAGAGGAGCAT
10 dna:chromosome chromosome:AGPv4:10:1:150982314:1 REF
position: 63515197-63515211
AAGCCCGAATTAGACAAGTTTGTGGTGGTC63515197TTCATTGACAACATTTTGATCTATTCCAAGAATGAGGAGGAGCAT
10 dna:chromosome chromosome:AGPv4:10:1:150982314:1 REF
position: 72885927-72885941
ATGGACTATCTCGATAAGTTTGTGGTGGTA72885927TTCATTGACAACATTCTGATTTATTCTCAAAGCGAAGAAGAGCAT
1 dna:chromosome chromosome:AGPv4:1:1:307041717:1 REF
position: 114113348-114113362
ATGCTCTTCTTTATTCTTGGAATATATTAG114113348AATGTTGTCAATGAACACTACCACAAACCTGTCCAGTTTGGGCAT
1 dna:chromosome chromosome:AGPv4:1:1:307041717:1 REF
position: 162659679-162659693
ATGCTCCTCTTTATTTTTGGAATAGATTAG162659679AATGTTGTCAATGAAGACCACCACAAACTTATCTAACTCGAGCAT
2 dna:chromosome chromosome:AGPv4:2:1:244442276:1 REF
position: 115435954-115435968
ACTTTTGGCAGGCCTCACCAACGGCTCCTC115435954AATGTTGTCAATGAACAGCTTGTAGAAAAGCCTCTCGTTCCCTTC
2 dna:chromosome chromosome:AGPv4:2:1:244442276:1 REF
position: 151489406-151489420
TGTTCCTCTTCATTTTTGGAATAGATCAAA151489406AATGTTGTCAATGAAGACCACCACACATTTATCCAACTCGAGCAT
2 dna:chromosome chromosome:AGPv4:2:1:244442276:1 REF
position: 190966608-190966622
AGAGAGAAGGCTTCCATTCAAGAGTTGATG190966608AATGTTGTCAATGAAATGATGTGGAACACAGAATTTGGTATTAGG
3 dna:chromosome chromosome:AGPv4:3:1:235667834:1 REF
position: 53299261-53299275
ATGCTCCTCTTCATTTTTGGAATAGATCAG53299261AATGTTGTCAATGAAGACCACCACAAATTTATCCAATTCGGGCAT
4 dna:chromosome chromosome:AGPv4:4:1:246994605:1 REF
position: 77581822-77581836
ATGCTACTCTTCATTTTTGGAATAGATCAG77581822AATGTTGTCAATGAAGACCACCACAAACTTGTCTAACTCAGGCAT
4 dna:chromosome chromosome:AGPv4:4:1:246994605:1 REF
position: 126064256-126064270
ATGCTCCTCTTCATTTTTGGAATAGATCAG126064256AATGTTGTCAATGAAGACCACCACAAACTTGTCTAACTCAGGCAT
4 dna:chromosome chromosome:AGPv4:4:1:246994605:1 REF
position: 228279988-228280002
ATGTTCTCCATCATACTTGGAATAAACCAG228279988AATGTTGTCAATGAATACCACGATGAACTTATCAAGAAATTCCAT
6 dna:chromosome chromosome:AGPv4:6:1:174033170:1 REF
position: 4950291-4950305
GGTAGAAATGTTGTTCATATGCCTAGGAGA4950291AATGTTGTCAATGAACCTTCTACAATTTATCATGCTTTAAAAGCT
7 dna:chromosome chromosome:AGPv4:7:1:182381542:1 REF
position: 102845778-102845792
ATGTTCTTCGTCATCTTTGGAATAGATCAG102845778AATGTTGTCAATGAATACCACAACAAACTTATCAAGATATTCCAT
7 dna:chromosome chromosome:AGPv4:7:1:182381542:1 REF
position: 175087146-175087160
GGTAGAAATGTTGTTCATATGCCTAGGAGA175087146AATGTTGTCAATGAACCTTCTACAATTTATCATGCTTTAAATGCT
8 dna:chromosome chromosome:AGPv4:8:1:181122637:1 REF
position: 83779419-83779433
AGAAGAAATGTTGTTCATATGCCTAGGAGA83779419AATGTTGTCAATGAACCTTCTACAATTTATCATGCTTTAAATGCT
9 dna:chromosome chromosome:AGPv4:9:1:159769782:1 REF
position: 52090413-52090427
ATGCTCCTTTTCATTTTTGGAATAGATCAG52090413AATGTTGTCAATGAAGACCACCACAAATTTATCCAACTCGGGCAT
9 dna:chromosome chromosome:AGPv4:9:1:159769782:1 REF
position: 57865548-57865562
ATGCTCCTCTTACTTTTTGGAATAGATCAA57865548AATGTTGTCAATGAAGACCACCATAAATTTATCCAACTCGGGCAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/AGPv4/TTCATTGACAACATT
lang : en | db : AGPv4 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.72:28206/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.090 | 0.012 | search_minus_done; http://172.18.8.72:28206/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=35
0.097 | 0.008 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).