GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 12:31:37, GGGenome : Amborella trichopoda genome, AMTR1.0 (Jan, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

AmTr_v1.0_scaffold00357 dna:supercontig supercontig:GCA_000471905.1:AmTr_v1.0_scaffold00357:1:33638:1
position: 17547-17561
TTTTTTTAGATTTTTTAGAATTTTTTGATA17547TTCATTGACAACATTGGGATGAAGCACTCAGATCTGGACCGCATA
AmTr_v1.0_scaffold00224 dna:supercontig supercontig:GCA_000471905.1:AmTr_v1.0_scaffold00224:1:181452:1
position: 18032-18046
TTTTTTTAGATTTTTTAGAATTTTTTGATA18032TTCATTGACAACATTAGGATGAAGCACTCAGATCTGGACCGCATT
AmTr_v1.0_scaffold00038 dna:supercontig supercontig:GCA_000471905.1:AmTr_v1.0_scaffold00038:1:5499001:1
position: 2277722-2277736
TCTAAACTATAATCTAGTTCATTATTAACA2277722TTCATTGACAACATTGAAAGGAACAAATCCTTATAAGTCAAAAAA
AmTr_v1.0_scaffold00028 dna:supercontig supercontig:GCA_000471905.1:AmTr_v1.0_scaffold00028:1:6207899:1
position: 3227022-3227036
TATTTCATATCCTCAGCAATATGGACAATG3227022TTCATTGACAACATTATGACATCTTCTGACATATGCTAGGTTGCA
AmTr_v1.0_scaffold00007 dna:supercontig supercontig:GCA_000471905.1:AmTr_v1.0_scaffold00007:1:9499498:1
position: 4774026-4774040
GCCGACTTAGGTCATTTCCTGACCACGCAA4774026TTCATTGACAACATTTGCCTCTAGCCTCAATGATTCGTTGAATAT
AmTr_v1.0_scaffold00023 dna:supercontig supercontig:GCA_000471905.1:AmTr_v1.0_scaffold00023:1:6666511:1
position: 6441007-6441021
TCTAGAGTGAATGCGTTTTTGGGTAATAAT6441007AATGTTGTCAATGAACATACGGTCTCTAATAAAAGCTGATTGTTC
AmTr_v1.0_scaffold00006 dna:supercontig supercontig:GCA_000471905.1:AmTr_v1.0_scaffold00006:1:9414115:1
position: 604353-604367
TAATGGAGGGCATACTTGGGTGAAACGGAA604353AATGTTGTCAATGAAGAGAAGCACATCTTGGCCTTCAGCATCTCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/AMTR1.0/TTCATTGACAACATT
lang : en | db : AMTR1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.75:28167/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.007 | search_minus_done; http://172.18.8.75:28167/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.086 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).