GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 10:51:59, GGGenome : Silkworm genome, ASM15162v1 (Feb, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaf107:797649-797663
CGGGTAGTGTTATTGTTAGAACATAGGACA797649TTCATTGACAACATTATCAAGATAAGTCTGCCTATACAGGGTGTC
scaf77:205831-205845
CGTGATCAAGAAGGACAGGATGTACTGCTC205831TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
scaf51:1555036-1555050
ACAAATCTCAGTAAATTTACTTTAGAATTT1555036TTCATTGACAACATTACGGAGTGAACTAACACAATGATACATAGA
scaf24:955300-955314
ACGAATGTTTCCGCTATTTCTGTTAAATTT955300TTCATTGACAACATTGTAGCATACAAGTTTAAAGACTTGCACAGA
scaf3:513724-513738
TTCCAGCTCGAAGGTAATATTTTAGTAAAT513724TTCATTGACAACATTTGGTATTCAAGATATACACTATAGTGTGCA
BABH01050344:420-434
TGGTATAATCCGAGGTTATAGTTAAAAAAA420AATGTTGTCAATGAACCAAAAAATTCAATACTTATTTTACAGTCA
scaf77:172290-172304
CACTTCTGATCCAGCCTGAGTGAAACGGAA172290AATGTTGTCAATGAAGAGCAGTACATCCTGTCCTTCTTGATCACG
scaf49:986324-986338
CTTTTTTGTTTTAAACTACAAAGAAGCCTT986324AATGTTGTCAATGAAATTTTTTAAAACAGGTTAGGGTTGTCTAAT
scaf18:2916064-2916078
CAATAAAATATCTCGTATTATGATGACAGT2916064AATGTTGTCAATGAAATGGTAGTTTTAAACATAAATGTCGTTTGT
scaf18:3860294-3860308
AGTTGAATCAATCTGTATAGTTTATAAGTG3860294AATGTTGTCAATGAAATAGTATTATAATAGGCTACTTCAGATTAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ASM15162v1/TTCATTGACAACATT
lang : en | db : ASM15162v1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.084 | 0.077 | search_plus_done; http://172.18.8.76:28136/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.095 | 0.011 | search_minus_done; http://172.18.8.76:28136/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.098 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).