GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:39:09, GGGenome : Tetranychus urticae genome, ASM23943v1 (Nov, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

HE587335 dna:supercontig supercontig:GCA_000239435.1:HE587335:1:723144:1
position: 384242-384256
TAAAGTAATCTTTTCATTATTCCTTGACCT384242TTCATTGACAACATTTTTTGTCTTCACCTTCAATAGAAATCATTT
HE587313 dna:supercontig supercontig:GCA_000239435.1:HE587313:1:2175382:1
position: 1218914-1218928
TGATCTTGAATTGTAATGTTTCCAAATATA1218914TTCATTGACAACATTTACAGAAATACAAAAACAGTGTTTGAAATT
HE587313 dna:supercontig supercontig:GCA_000239435.1:HE587313:1:2175382:1
position: 1581782-1581796
ATTTAGAACTTTAATCAGCGTCGAGTAAAC1581782TTCATTGACAACATTTAACGATTCAATTTGGACGGAGTTGCTAAA
HE587335 dna:supercontig supercontig:GCA_000239435.1:HE587335:1:723144:1
position: 364696-364710
AAATGATTTCTATTGAAGGTGAAGACAAAA364696AATGTTGTCAATGAAAGGTCAAAGAATAATGAAAAGATTACTTTA
HE587304 dna:supercontig supercontig:GCA_000239435.1:HE587304:1:4539973:1
position: 10387-10401
TTTCATGAGCTGAGAGCGTTTTACCCTTTC10387AATGTTGTCAATGAAAATGCTGTTGAAAAGTTTAATGTAAACTGA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ASM23943v1/TTCATTGACAACATT
lang : en | db : ASM23943v1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.084 | 0.077 | search_plus_done; http://172.18.8.76:28161/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.094 | 0.010 | search_minus_done; http://172.18.8.76:28161/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.095 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).