GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:04:21, GGGenome : Physcomitrella patens genome, ASM242v1 (Jul, 2006)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

DS545228.1 dna:scaffold scaffold:ASM242v1:DS545228.1:1:407184:1
position: 104861-104875
TTATAAATAGGTTTTAGCTTGTTTTTACTT104861TTCATTGACAACATTCATCAAAATTAAGGACCAATTATTGACAAC
DS545221.1 dna:scaffold scaffold:ASM242v1:DS545221.1:1:432565:1
position: 52899-52913
TTATAAATGTAGCAAAGAAGGTTGATGATT52899TTCATTGACAACATTTATCCAAATTAAGATAAAAGATAACAAATC
DS545085.1 dna:scaffold scaffold:ASM242v1:DS545085.1:1:846302:1
position: 98658-98672
TTACAAATGCAGCAAAGGCGATGGAGGCTT98658TTCATTGACAACATTCATCAAAATCAAGATGAAAACCTTCTTTAT
DS545072.1 dna:scaffold scaffold:ASM242v1:DS545072.1:1:931471:1
position: 887235-887249
TTGCAAATGTAGCAAAAGAGATTGAGATTT887235TTCATTGACAACATTCAATAAAATCAAGATAAAAAATAATAAGAT
DS545045.1 dna:scaffold scaffold:ASM242v1:DS545045.1:1:1020455:1
position: 33902-33916
TTGCAAATACAGTAAAGAGAGTTGAAGCTT33902TTCATTGACAACATTCATCAAAATCAAGATAAAGAATAGCAAATC
DS545039.1 dna:scaffold scaffold:ASM242v1:DS545039.1:1:1075367:1
position: 354792-354806
CTATAAATGCAACAAAGAAGATTGAGGCTT354792TTCATTGACAACATTTATCAAAATCAAAATAAAGAATAACAAGAT
DS544984.1 dna:scaffold scaffold:ASM242v1:DS544984.1:1:1459480:1
position: 125678-125692
TTTCAAATGTAGCAAAGAAAGTAGAAGCTT125678TTCATTGACAACATTCATCAAAATCAAGTTGAAGACCTTTTTTTA
DS544956.1 dna:scaffold scaffold:ASM242v1:DS544956.1:1:1795736:1
position: 1484439-1484453
TAATGAGATACGTGTATAAGACGCGCAGAT1484439TTCATTGACAACATTATACTCATCTAAGGCATGGAGAGAGACAAA
DS544936.1 dna:scaffold scaffold:ASM242v1:DS544936.1:1:2165708:1
position: 966046-966060
GTTTATTTGGTGGTGGCCTTATTTGTTGGT966046TTCATTGACAACATTGTATCCATTGTTTTTTAATGTAATTGCAAC
DS544910.1 dna:scaffold scaffold:ASM242v1:DS544910.1:1:2717955:1
position: 1006980-1006994
TTATAAATGCAGCAAAGAGAATTGAGATTT1006980TTCATTGACAACATTCATTAAAATTAAGATGAAAAATAAAAAATC
DS544893.1 dna:scaffold scaffold:ASM242v1:DS544893.1:1:4046325:1
position: 2197095-2197109
TCTTATAAACAACAAAGAAGGTCAATGCTT2197095TTCATTGACAACATTTATTTAAAAGATATGAAGATCTTAGTTATA
DS545260.1 dna:scaffold scaffold:ASM242v1:DS545260.1:1:355574:1
position: 68498-68512
GATTTGCTATTCTTCATCTTGGTTTTAATG68498AATGTTGTCAATGAAAAAAATCAACCTTCTTTGCTGTATTTATAA
DS545123.1 dna:scaffold scaffold:ASM242v1:DS545123.1:1:725545:1
position: 64491-64505
GATTTTTTTTTCTTCATCTTTATTTTGATG64491AATGTTGTCAATGAAAAATATTAACTTTTTTTGCTACATTTGTAA
DS545098.1 dna:scaffold scaffold:ASM242v1:DS545098.1:1:809795:1
position: 153962-153976
GAATTTTTATTCTTCATCTTCATTTTGATA153962AATGTTGTCAATGAAAATCATCAATAATCTTTGTTACATTAGTAA
DS545025.1 dna:scaffold scaffold:ASM242v1:DS545025.1:1:1147373:1
position: 611954-611968
GATTTATTATCCTTCATCTTGATTTAGATG611954AATGTTGTCAATGAATAGCATCAACTTTTTTTATTGCATTTGCTA
DS544992.1 dna:scaffold scaffold:ASM242v1:DS544992.1:1:1372085:1
position: 177839-177853
TTTTATTTATTTTTTATCTTGATTTTCATA177839AATGTTGTCAATGAAAAGCCTCAACTCTCTTAACTATAGTTGTAA
DS544943.1 dna:scaffold scaffold:ASM242v1:DS544943.1:1:1995183:1
position: 207561-207575
GATTTTCTATTCTTCATCTAGATTTTAATA207561AATGTTGTCAATGAAAGGCCTCTATCTTCTTTGCTACATTTATAA
DS544937.1 dna:scaffold scaffold:ASM242v1:DS544937.1:1:2137979:1
position: 2048271-2048285
TTATATCCCTGCTAATTTATAATAGTGATA2048271AATGTTGTCAATGAAAAACTTAGCTATTTTTTTACTTGTGATAGA
DS544934.1 dna:scaffold scaffold:ASM242v1:DS544934.1:1:2275928:1
position: 1477774-1477788
TTTATGATCACTAAATAAAATGTTACTATT1477774AATGTTGTCAATGAATGAATATTATTAATGTTGTATAGATAAGTT
DS544927.1 dna:scaffold scaffold:ASM242v1:DS544927.1:1:2378804:1
position: 203676-203690
ATAAAGAAAGTTTTTATCTTGATTTTGATG203676AATGTTGTCAATGAAAAGCCTCCATCACCTTTGCTACATTTACAA
scaffold_15 dna:scaffold scaffold:ASM242v1:scaffold_15:1:2945049:1
position: 866189-866203
GATTTGTTATTTTTTATTTTGGTTTTGATC866189AATGTTGTCAATGAAAAACTTCAACCTTCTTTGTTGCATTAGTAA
DS544893.1 dna:scaffold scaffold:ASM242v1:DS544893.1:1:4046325:1
position: 786008-786022
ATTTATTGATTTTTTATTTTAAATTTGCTT786008AATGTTGTCAATGAAAAATATTGGACTTCTTTTTTTTTATTTGTA
DS544890.1 dna:scaffold scaffold:ASM242v1:DS544890.1:1:5387533:1
position: 4470972-4470986
AGATTTACTATTTGTTAGATGGTTTTAATA4470972AATGTTGTCAATGAAAAACCTCCACTCTCTTTGATGTATTTGCAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ASM242v1/TTCATTGACAACATT
lang : en | db : ASM242v1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.073 | search_plus_done; http://172.18.8.75:28192/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.090 | 0.010 | search_minus_done; http://172.18.8.75:28192/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=39
0.096 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).