GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-05-19 08:31:58, GGGenome : Actinidia chinensis genome

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr01
position: 15707602-15707616
AATACTATTTAACAGGAAAAACTTATGTAT15707602TTCATTGACAACATTAAATAAGGATTACAGTCAAGTAACGTACCA
Chr29
position: 6249531-6249545
CGAGATGCTGAAGGGCAGGATGTGCTGCTC6249531TTCATTGACAACATTTTCAGGTTTACCCAGGTGGGATTGCTTTTT
Chr13
position: 17114939-17114953
TTAAAGAAAGCCCACCTGGGTAAACCTGAA17114939AATGTTGTCAATGAAAAGCAGCACATCCTGCCCTTCAGCATCTCG
Chr23
position: 13443795-13443809
ACAGATCAAAAAAACTGACGCCAGGGGCAA13443795AATGTTGTCAATGAAAGTATGGGAGTAGTTTGATTGGGTAAGCCC
Chr24
position: 15777400-15777414
AGGGATCAACATAACCTGAGGCCTGAACAA15777400AATGTTGTCAATGAATAATTTCTATATTCAGATGTTTTGGTTATG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/A_chinensis_Hongyang/TTCATTGACAACATT
lang : en | db : A_chinensis_Hongyang | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.070 | search_plus_done; http://172.18.8.72:28281/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.081 | 0.004 | search_minus_done; http://172.18.8.72:28281/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.083 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).