GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-04-05 13:18:11, GGGenome : Aspergillus nidulans (FGSC A4) genome, s10-m04-r06 (Apr, 2016)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

ChrVII_A_nidulans_FGSC_A4 (4550218 nucleotides)
position: 3532912-3532926
CACCTCAGAACCGGCCTGGGTGAAACGGAA3532912AATGTTGTCAATGAAGAGCAGCACGTCCTGACCCTCCTCGTCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:


GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).