GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-04-11 09:00:00, GGGenome : Aspergillus oryzae (RIB40) genome, s01-m09-r03 (Oct, 2015)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr8_A_oryzae_RIB40 (3395259 nucleotides)
position: 2103103-2103117
CACCTCAGAACCGGCCTGGGTGAAACGGAA2103103AATGTTGTCAATGAAGAGCAGCACATCCTGACCTTCCTCGTCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:


GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).