GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-08-15 00:06:28, GGGenome : Aedes aegypti genome, AaegL3 (Dec, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

supercont1.1295 dna:supercontig supercontig:AaegL3:supercont1.1295:1:143593:1
position: 91031-91045
AATCTCCTTCTGATCGTTCAAAATTCGTAG91031TTCATTGACAACATTTGATAAAAACAGCCACTAAAAAAGGATATT
supercont1.541 dna:supercontig supercontig:AaegL3:supercont1.541:1:819817:1
position: 292038-292052
TTGATCAAAAAACAATAACTGATCGATGTT292038TTCATTGACAACATTTACAGGATGAAACCAAAAGGTGCTAAAAAG
supercont1.67 dna:supercontig supercontig:AaegL3:supercont1.67:1:3004230:1
position: 668459-668473
ATGATCAAAAAACAATAACTGATCGATGTT668459TTCATTGACAACATTTACAGGATGAAACCTAAAGGTGCTAAAAAG
supercont1.36 dna:supercontig supercontig:AaegL3:supercont1.36:1:3595646:1
position: 3456408-3456422
CATCAATTTATCTCAGTATATAAAAGACGG3456408TTCATTGACAACATTTTTTTTCTCGCTAAGAAAGAGGAGATTGTT
supercont1.1 dna:supercontig supercontig:AaegL3:supercont1.1:1:5856339:1
position: 1593639-1593653
AACAACTTTCAAAACACCTAATTTCAGTTT1593639TTCATTGACAACATTTAAAGATCATTACCGATATTTGAATGTTTG
supercont1.1312 dna:supercontig supercontig:AaegL3:supercont1.1312:1:135540:1
position: 33451-33465
TGCCAAAAATCTTTGGAATATCATGATAAT33451AATGTTGTCAATGAAGTTGTATAGTGGCCGTTCATTAATAACGCA
supercont1.457 dna:supercontig supercontig:AaegL3:supercont1.457:1:950089:1
position: 470034-470048
CTTTTTAGCACCTTTTGGTTTCATCCTGTA470034AATGTTGTCAATGAAAACATCGATTAGTTATTATTTTTTGATCAA
supercont1.315 dna:supercontig supercontig:AaegL3:supercont1.315:1:1341213:1
position: 184620-184634
CTTTTGTTGTAGAATCGTGATGTAAGGTCA184620AATGTTGTCAATGAACCTTTGTTATACTCTGCGGATTCCTAGTTG
supercont1.85 dna:supercontig supercontig:AaegL3:supercont1.85:1:2749456:1
position: 596593-596607
TACCTCAGAACCAGCTTGGGTGAAACGGAA596593AATGTTGTCAATGAAGAGCAGCACATCCTGTCCTTCCTGATCACG
supercont1.69 dna:supercontig supercontig:AaegL3:supercont1.69:1:2946165:1
position: 134132-134146
TACCTCGGAACCGGCCTGGGTGAAACGGAA134132AATGTTGTCAATGAAGAGCAGCACATCCTGTCCCTCTTGATCGCG
supercont1.13 dna:supercontig supercontig:AaegL3:supercont1.13:1:4376253:1
position: 1297560-1297574
AACGGCCAAAGCAGTTCAAAGATCTCTGCA1297560AATGTTGTCAATGAAAATTGAACGCAGTATTTTCGATGCACTTTT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/AaegL3/TTCATTGACAACATT
lang : en | db : AaegL3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.083 | 0.076 | search_plus_done; http://172.18.8.76:28132/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.095 | 0.012 | search_minus_done; http://172.18.8.76:28132/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.098 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).