GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-02-28 08:30:37, GGGenome : Aedes albopictus genome, AaloF1 (Nov, 2015)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JXUM01S000228 dna:supercontig supercontig:AaloF1:JXUM01S000228:1:556221:1
position: 431892-431906
GGAGAGTAGGAAAACAGCCGATGTAGTTAA431892TTCATTGACAACATTCTGAAAAAAAAAGCGTTTTCTCTCTTGATT
JXUM01S002115 dna:supercontig supercontig:AaloF1:JXUM01S002115:1:245863:1
position: 154068-154082
CGTGACCAGGAAGGACAGGATGTGCTGCTG154068TTCATTGACAACATTTTCCGTTTCACCCAAGCCGGTTCCGAGGTA
JXUM01S002395 dna:supercontig supercontig:AaloF1:JXUM01S002395:1:222264:1
position: 44278-44292
CAAACGACAACTGTAACGACAAAGAGGATT44278TTCATTGACAACATTTCCCTTATGCTACAGCAATAGCACGGTACT
JXUM01S002719 dna:supercontig supercontig:AaloF1:JXUM01S002719:1:209885:1
position: 151645-151659
CTCTACCAGCAACCACGTACTTCGTTGGCG151645TTCATTGACAACATTCATCGTACTCACAGCATTAGTTTCAGTTTA
JXUM01S002858 dna:supercontig supercontig:AaloF1:JXUM01S002858:1:203308:1
position: 119692-119706
TTAATTTGTATGAAAATCGAGTTTGATAAG119692TTCATTGACAACATTTCGGATTCGCAGCAATCATAGCTAATATAT
JXUM01S004922 dna:supercontig supercontig:AaloF1:JXUM01S004922:1:126792:1
position: 39747-39761
CAGCTGGCAACTCATTTGTTCAATATGGGA39747TTCATTGACAACATTCTTAACTCATCGAAACACACTGAGGAACAT
JXUM01S010431 dna:supercontig supercontig:AaloF1:JXUM01S010431:1:35388:1
position: 21178-21192
TATTTTGTTCTTGATATGATATCATAGTTG21178TTCATTGACAACATTGGAGGCTTAATAAGGGTGGGGTTATGAAGA
JXUM01S013589 dna:supercontig supercontig:AaloF1:JXUM01S013589:1:12780:1
position: 5246-5260
CGCGATCAAGAGGGACAGGATGTGCTGCTC5246TTCATTGACAACATTTTCCGCTTCACCCAGGCCGGTTCCGAGGTA
JXUM01S003071 dna:supercontig supercontig:AaloF1:JXUM01S003071:1:192241:1
position: 74539-74553
CTAGTGAAATGATGTTCGGTGTCTGAAGAT74539AATGTTGTCAATGAAATATCCATGAACTTTTATACACTCAGTAGC
JXUM01S003501 dna:supercontig supercontig:AaloF1:JXUM01S003501:1:177431:1
position: 60533-60547
AAAAAAACGATGCGTGCGCCTGTCTATAGA60533AATGTTGTCAATGAAGAATCATATTCAACAGTTTAACAAAAATTC
JXUM01S004253 dna:supercontig supercontig:AaloF1:JXUM01S004253:1:150437:1
position: 51771-51785
AAATATTAGGTATGATTGCAGCGAATCCGA51771AATGTTGTCAATGAACTTTATGAAACTCGATTTCCATACAAATAA
JXUM01S006546 dna:supercontig supercontig:AaloF1:JXUM01S006546:1:88649:1
position: 62514-62528
AGTACCGTGCTATTGCTGTAGCATAAGGGA62514AATGTTGTCAATGAAAATCCTCTTTGTCGTTACAGTTGTCGTTGC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/AaloF1/TTCATTGACAACATT
lang : en | db : AaloF1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.083 | 0.075 | search_plus_done; http://172.18.8.72:28001/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.094 | 0.011 | search_minus_done; http://172.18.8.72:28001/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.097 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).