GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-16 12:04:32, GGGenome : Anopheles darlingi genome, AdarC3 (Jan, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_539 dna:supercontig supercontig:AdarC3:scaffold_539:1:70115:1
position: 68528-68542
ATGCATGCGTGTTTGGTCGTATCTTTTTAG68528AATGTTGTCAATGAATCACCGCTAAAAGTAGTGCACGAGAGAAAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/AdarC3/AATGTTGTCAATGAA
lang : en | db : AdarC3 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.084 | 0.077 | search_plus_done; http://172.18.8.76:28134/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.092 | 0.008 | search_minus_done; http://172.18.8.76:28134/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=49
0.092 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).