GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 12:28:40, GGGenome : Aspergillus kawachii genome, IFO 4308 (Nov, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

DF126475.1 Aspergillus kawachii IFO 4308 DNA, contig: scaffold00029, whole genome shotgun sequence
position: 371202-371216
CACCTCAGAACCGGCCTGGGTGAAACGGAA371202AATGTTGTCAATGAAGAGCAGCACGTCCTGACCCTCCTCGTCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Akaw_assembly01/TTCATTGACAACATT
lang : en | db : Akaw_assembly01 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.090 | 0.082 | search_plus_done; http://172.18.8.72:28014/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.096 | 0.007 | search_minus_done; http://172.18.8.72:28014/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.097 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).