GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-05-27 02:49:32, GGGenome : Arabidopsis lyrata genome, v.1.0 (Dec, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

6 dna:chromosome chromosome:v.1.0:6:1:25113588:1
position: 3612279-3612293
AGGAACAAGGCTCACCTGAGTGAAACGGAA3612279AATGTTGTCAATGAAAAGCAAGACGTCTTGGCCTTCGGCATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Araly_v.1.0/AATGTTGTCAATGAA
lang : en | db : Araly_v.1.0 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.082 | 0.073 | search_plus_done; http://172.18.8.75:28168/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.004 | search_minus_done; http://172.18.8.75:28168/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=49
0.086 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).