GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 10:46:48, GGGenome : Cave fish genome, AstMex102 (Apr, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

KB882202.1 dna:scaffold scaffold:AstMex102:KB882202.1:1:6422343:1 REF
position: 2697461-2697475
TATTAACAATTTTACACCAGTGCTCTATGA2697461TTCATTGACAACATTTGGTAAAGTCAGTACATATTGGTCATTGCT
KB882208.1 dna:scaffold scaffold:AstMex102:KB882208.1:1:2159269:1 REF
position: 556034-556048
GATTGATAAAGTAGGGCCCTTGGATTTCTG556034TTCATTGACAACATTACATTATCACAGCTAGAACCTTAGTAATTT
KB882160.1 dna:scaffold scaffold:AstMex102:KB882160.1:1:2574683:1 REF
position: 954784-954798
GGCTTTAGTTCCCTCAAGTTTTGTGCCTCA954784AATGTTGTCAATGAAACTATCATTTGATGCCAATGCTAAAATGAA
KB872056.1 dna:scaffold scaffold:AstMex102:KB872056.1:1:296072:1 REF
position: 270771-270785
CAATATCAACTCAACATTTTTAGAGAACTG270771AATGTTGTCAATGAATCTAATACAAGCAACAGATACCTCTATTAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/AstMex102/TTCATTGACAACATT
lang : en | db : AstMex102 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.084 | 0.076 | search_plus_done; http://172.18.8.76:28120/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.093 | 0.010 | search_minus_done; http://172.18.8.76:28120/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.095 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).