GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-06 04:40:34, GGGenome : Silkworm genome, SilkBase assembly (Nov, 2016)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Bomo_Chr8
position: 14980022-14980036
ACAAATCTCAGTAAATTTACTTTAGAATTT14980022TTCATTGACAACATTACGGAGTGAACTAACACAATGATACATAGA
Bomo_Chr9
position: 7080381-7080395
CGTGATCAAGAAGGACAGGATGTACTGCTC7080381TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
Bomo_Chr22
position: 5791914-5791928
ATAATCTGAAGTAGCCTATTATAATACTAT5791914TTCATTGACAACATTCACTTATAAACTATACAGATTGATTCAACT
Bomo_Chr22
position: 6781604-6781618
ACAAACGACATTTATGTTTAAAACTACCAT6781604TTCATTGACAACATTACTGTCATCATAATACGAGATATTTTATTG
Bomo_Chr24
position: 14646882-14646896
CGGGTAGTGTTATTGTTAGAACATAGGACA14646882TTCATTGACAACATTATCAAGATAAGTCTGCCTATACAGGGTGTC
Bomo_Chr6
position: 12709785-12709799
CTTTTTTGTTTTTAACTACAAAGAAGCCTT12709785AATGTTGTCAATGAAATTTTTTAAAACAGGTTAGGGTTGTCTAAT
Bomo_Chr9
position: 7044102-7044116
CACTTCTGATCCAGCCTGAGTGAAACGGAA7044102AATGTTGTCAATGAAGAGCAGTACATCCTGTCCTTCTTGATCACG
Bomo_Chr11
position: 17534086-17534100
TCTGTGCAAGTCTTTAAACTTGTATGCTAC17534086AATGTTGTCAATGAAAAATTTAACAGAAATAGCGGAAACATTCGT
Bomo_Chr15
position: 9511570-9511584
TGCACACTATAGTGTATATCTTGAATACCA9511570AATGTTGTCAATGAAATTTACTAAAATATTACCTTCGAGCTGGAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Bomo_silkbase/TTCATTGACAACATT
lang : en | db : Bomo_silkbase | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.073 | search_plus_done; http://172.18.8.72:28274/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.006 | search_minus_done; http://172.18.8.72:28274/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.089 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).