GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-09-16 23:57:36, GGGenome : Brassica napus genome, Genoscope v4.1 (Aug, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chrA10
position: 15251335-15251349
CGTGATGCTGAAGGCCAAGATGTGTTGCTT15251335TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCTACTGTGTT
chrAnn_random
position: 6127105-6127119
CGTGATGCTGAGGGCCAAGATGTGTTGCTT6127105TTCATTGACAACATTTTCCGATTCACTCAGGTGAGCTATGTTGTT
chrAnn_random
position: 43055008-43055022
GAAAGAATATGTTTAGTTTGTGCTTTAGAT43055008TTCATTGACAACATTCAAAAGTTTTTCTACGAGAATTCAGCGTAG
chrC03
position: 45007685-45007699
ATAACTACTTAAAAGTAAAAAATCATATCG45007685TTCATTGACAACATTTGGGTTGAAAAGCTTATTTATAAATGCCAA
chrC09
position: 46743753-46743767
CGTGATGCTGAAGGCCAAGATGTGTTGCTT46743753TTCATTGACAACATTTTCCGTTTCACTCAGGTGAACTTCTATGTT
chrA10
position: 15247834-15247848
AACACAGTAGCTCACCTGAGTGAAACGGAA15247834AATGTTGTCAATGAAAAGCAACACATCTTGGCCTTCAGCATCACG
chrAnn_random
position: 6122344-6122358
AACAACATAGCTCACCTGAGTGAATCGGAA6122344AATGTTGTCAATGAAAAGCAACACATCTTGGCCCTCAGCATCACG
chrC02
position: 443288-443302
AACAACATAGCTCACCTGAGTGAAACGGAA443288AATGTTGTCAATGAAAAGCAACACATCTTGGCCCTCGGCATCACG
chrC05
position: 8375180-8375194
AGTAAATTTATAATTCATATGTCGTATGTA8375180AATGTTGTCAATGAAAACATACAAACCTGGAGTAAATTGTAATTT
chrC09
position: 46740232-46740246
AAGAACAGAGCTCACCTGAGTGAAACGGAA46740232AATGTTGTCAATGAAAAGCAACACATCTTGGCCTTCGGCATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Brana_v4.1/TTCATTGACAACATT
lang : en | db : Brana_v4.1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.073 | search_plus_done; http://172.18.8.77:28235/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.007 | search_minus_done; http://172.18.8.77:28235/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.090 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).