GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 10:41:05, GGGenome : Brassica rapa genome, v1.5 (May, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

A02:1327601-1327615
CGTGATGCTGAGGGCCAAGATGTGTTGCTT1327601TTCATTGACAACATTTTCCGATTCACTCAGGTGAGCTATGTTGTT
A10:14144067-14144081
CGTGATGCTGAAGGCCAAGATGTGTTGCTT14144067TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCTACTGTGTT
A02:1321959-1321973
AACAACATAGCTCACCTGAGTGAATCGGAA1321959AATGTTGTCAATGAAAAGCAACACATCTTGGCCCTCGGCATCACG
A02:11752653-11752667
CTACGCTGAATTCTCAAAGAAAAACTTTTG11752653AATGTTGTCAATGAAATCTAAAGCACAAACTAAACATATTCTTTC
A10:14136132-14136146
AACACAGTAGCTCACCTGAGTGAAACGGAA14136132AATGTTGTCAATGAAAAGCAACACATCTTGGCCTTCAGCATCACG
Scaffold024314:100-114
AACAACATAGCTCACCTGAGTGAATCGGAA100AATGTTGTCAATGAAAAGCAACACAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Brapa_v1.5/TTCATTGACAACATT
lang : en | db : Brapa_v1.5 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.72:28273/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.005 | search_minus_done; http://172.18.8.72:28273/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.086 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).