GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:41:04, GGGenome : Capitella teleta genome, Capitella teleta v1.0 (Dec, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

CAPTEscaffold_774 dna:supercontig supercontig:GCA_000328365.1:CAPTEscaffold_774:1:145939:1
position: 5418-5432
TTGTTTGACATCTTCCTCTTTCACAGCATC5418TTCATTGACAACATTAGAGAATATGGCACTGTTGCCTCCATCACC
CAPTEscaffold_240 dna:supercontig supercontig:GCA_000328365.1:CAPTEscaffold_240:1:293278:1
position: 189151-189165
AAATCATCCTCAATTTCCATTTTACATGAT189151TTCATTGACAACATTTCATCGTTTTCTCTGGCTTACATTAAAACA
CAPTEscaffold_15 dna:supercontig supercontig:GCA_000328365.1:CAPTEscaffold_15:1:802257:1
position: 760961-760975
CAATTGATAAGTATAGAAGTAAGTCAGCTT760961TTCATTGACAACATTGATATTAGCAATCTTTCAAGAGCCGAGTAT
CAPTEscaffold_13 dna:supercontig supercontig:GCA_000328365.1:CAPTEscaffold_13:1:840275:1
position: 593647-593661
CGTGATCAGGAGGGTCAGGATGTGCTTCTC593647TTCATTGACAACATTTTCCGCTTCACACAGGCCGGCTCTGAGGTA
CAPTEscaffold_376 dna:supercontig supercontig:GCA_000328365.1:CAPTEscaffold_376:1:213493:1
position: 6029-6043
CATTTGGAGGCAACAGTGCCATATTCTCTT6029AATGTTGTCAATGAAGATGCTGTGAAAGAGGAAGATGTCAAACAA
CAPTEscaffold_92 dna:supercontig supercontig:GCA_000328365.1:CAPTEscaffold_92:1:457531:1
position: 189595-189609
CAATTACACAGCTGTTTTGGGTAAAAAAAT189595AATGTTGTCAATGAATGCCCTACATGATTGTATAATCATCCTTTG
CAPTEscaffold_55 dna:supercontig supercontig:GCA_000328365.1:CAPTEscaffold_55:1:606270:1
position: 67139-67153
AATTATTTACAAAACAATTGTAAAAATTGT67139AATGTTGTCAATGAAGAAATGAAGAAAGTGCACAAAACATAAATG
CAPTEscaffold_33 dna:supercontig supercontig:GCA_000328365.1:CAPTEscaffold_33:1:658180:1
position: 395711-395725
TAACTCTGATTGAAATCTCAATTCGTTAGC395711AATGTTGTCAATGAAAAATGCAAACTTCTCGTCCTATGTGAACAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Capte_v1.0/TTCATTGACAACATT
lang : en | db : Capte_v1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.073 | search_plus_done; http://172.18.8.76:28138/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.006 | search_minus_done; http://172.18.8.76:28138/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.087 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).