GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-02-28 08:23:54, GGGenome : Citrus clementina genome, v1.0

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_5:9679321-9679335
AGAACCAAAGCAAAAATGAAACATTTCTTC9679321TTCATTGACAACATTGCCATTTCCATTCTCATTATTTCTCTTAAA
scaffold_6:9816320-9816334
AGAACCAAAGCAAAAATTAAAGGTTTCTTC9816320TTCATTGACAACATTACCATTTCCACTCTTATTATTTCTCTTACA
scaffold_7:1953447-1953461
TACAATCGTTGGAAAACGACACCAACGATG1953447TTCATTGACAACATTTTTATGTCAAATCAGTCGCAAAGTGATCAA
scaffold_7:6302617-6302631
ATAACCAAAGCAAAAATTAAAGGTTTCTTC6302617TTCATTGACAACATTACCATTTCCACTCTTATTATTTCTCTTACA
scaffold_1:4071345-4071359
TTTAAGAGAAATAATGAGAGTGGAAATGGC4071345AATGTTGTCAATGAAGAAGAAATGTTTCATTTTTGCTTTGGTTCT
scaffold_2:8574206-8574220
TGTAAGAGAAATAATAAGAGTGGAAATGGC8574206AATGTTGTCAATGAAGAAGAAACCTTTCATTTTTGCTTTGGTTCT
scaffold_5:29448020-29448034
ATACCTTAGGATTAGACTTTGCAAATGGCA29448020AATGTTGTCAATGAAGTGTCCCGTAACAACCATGCAACCTTTCTT
scaffold_5:31550983-31550997
TGTAAGAGAAATAATAAGAGTGGAAATGGC31550983AATGTTGTCAATGAAGAAGAAACCTTTCATTTTTGCTTTGGTTCT
scaffold_6:1645577-1645591
CAACATGCTCTTTGTTTGTGAGTAGATCAA1645577AATGTTGTCAATGAACACCACTATGAATTTGTCTAGGTAGTCTTT
scaffold_8:15263131-15263145
TGTAAGAGAAATAATAAGAGTAGAAATGGC15263131AATGTTGTCAATGAAGAAAAAACCTCATCCAAAATTTTCCCTCTT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Cclementina_v1/TTCATTGACAACATT
lang : en | db : Cclementina_v1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.082 | 0.074 | search_plus_done; http://172.18.8.74:28294/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.090 | 0.008 | search_minus_done; http://172.18.8.74:28294/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.094 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).