GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-10-26 08:22:59, GGGenome : Cucumis sativus (Chinese long) genome, v2

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr5
position: 20077419-20077433
TTTTGGCATATTTACCTGGGTAAAGCGGAA20077419AATGTTGTCAATGAAGAGAAGCACATCCTGTCCTTCAGCATCACG
Chr1
position: 17136519-17136533
AGTTCTATTCTTTTCAATAGCATTTATTTC17136519TTCATTGACAACATTCTTCCATCTAGGACACTCTAAAGTAGTGTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : https://gggenome.dbcls.jp/ChineseLong_v2/AATGTTGTCAATGAA
lang : en | db : ChineseLong_v2 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.078 | 0.069 | search_plus_done; http://172.18.8.72:28277/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.004 | search_minus_done; http://172.18.8.72:28277/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=49
0.083 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).