GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 12:40:24, GGGenome : Cucurbita moschata (Rifu) genome, v1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Cmo_Chr00
position: 6987489-6987503
TAATTTATACGCGCCTGCGGCCATCATCAT6987489TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATCAAC
Cmo_Chr00
position: 16578829-16578843
TAATTTAGACGCGCCTGCAGCCATCATCAT16578829TTCATTGACAACATTCATTATCAGATAGTCAGACAATCCATCGAT
Cmo_Chr00
position: 16735467-16735481
TAATTTATACGCGCCTGCAACCATCATCAT16735467TTCATTGACAACATTCATTATCAGATAGTCAGACAATCCATCGAT
Cmo_Chr09
position: 8760045-8760059
TAATTTATACGCGCCTGCGACCATCATCAT8760045TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATCGAT
Cmo_Chr09
position: 9767005-9767019
TAATTTATACGCACCTGCGGCCATCATCAT9767005TTCATTGACAACATTCATTATCAGATAGTCGAAAATCCATCGATA
Cmo_Chr09
position: 9897044-9897058
TAATTTATACGCGCCTGCGGCCATCATCAT9897044TTCATTGACAACATTCATTATCAGATAGTTGGAAATCCATCATCA
Cmo_Chr09
position: 10108484-10108498
TAATTTATACGCGCCTGTGGCCATCATCAT10108484TTCATTGACAACATTCATTATCAGATAGTCGGATAATCCATCAAT
Cmo_Chr10
position: 8157680-8157694
TAATTTATACGCGCCTGCGGCCATCATCAT8157680TTCATTGACAACATTCATTATCAGATAGTCAGACAATCCATCGAT
Cmo_Chr11
position: 7527521-7527535
TAATTTATACGTGCCTGCAGTCATCATCAT7527521TTCATTGACAACATTCATTATCAGATAGTCGGACAATACATTGAT
Cmo_Chr12
position: 5334916-5334930
TAATTTATACGCGCCTGCAGTCATCATCAT5334916TTCATTGACAACATTCATTATCAGATAGTTAGACAATCCATCGAT
Cmo_Chr14
position: 6374168-6374182
TAATTTATACGTGCCTGCGGCCATCATCAT6374168TTCATTGACAACATTCATTACCAGATAGTCGGACAATCCATCGAT
Cmo_Chr14
position: 6796024-6796038
TAATTTATACGCGCCTGTGGCCATCATCAT6796024TTCATTGACAACATTCATTATCAGATAGTCAGACAATCCATTGAT
Cmo_Chr18
position: 4838120-4838134
AAGGAATGTCTAAACATGTTTGTTATCGTG4838120TTCATTGACAACATTCTAATATACTTGAAAATGGATCAAGAACAC
Cmo_Chr20
position: 8276356-8276370
TAATTTATACGCGCCTGCAGCCATCATCAT8276356TTCATTGACAACATTCATTATCAGATAGTCAGACAATCCATCAAT
Cmo_Chr00
position: 6076724-6076738
ATCGATGGATTGTCCGACTATCTGATAATG6076724AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cmo_Chr00
position: 6165231-6165245
ATCGATGGATTATCAGACTGTTTGATAATG6165231AATGTTGTCAATGAAATGATGATGGTTGCTGGTGCGTATAAAATA
Cmo_Chr00
position: 16581816-16581830
ATCGATGGATTGTCTGACTATCTGATAATG16581816AATGTTGTCAATGAAATGATGATGGCTGCAGACGCGTCTAAATTA
Cmo_Chr00
position: 18719386-18719400
ATCGATGGATTGTCTGACTATCTGATAATG18719386AATGTTGTCAATGAAATGATGATGGTTGCAGGCGCGTATAAATTA
Cmo_Chr00
position: 19887776-19887790
ATCGATGGATTGTCTGACTATCTGATAATG19887776AATGTTGTCAATGAAATGATGATGGTTGCAGGCGCGTATAAATTA
Cmo_Chr05
position: 6342073-6342087
ATCGATAGATTGTCCGACTATCTAATATTG6342073AATGTTGTCAATGAAATGATGATGGCCGCAAGCGCGTATAAATTA
Cmo_Chr05
position: 10540825-10540839
CCTCTCCAACCGATGCAGGATCTCACAAAA10540825AATGTTGTCAATGAAAATTTTTTGTTCGGGTAGTAGCCCTTATGG
Cmo_Chr08
position: 4849854-4849868
TGCCATCTACATGCTACTATTTTCAAACAC4849854AATGTTGTCAATGAAAGGCAAAGAATTCATCTCCTAGAGTATTGC
Cmo_Chr13
position: 3620873-3620887
ATTGATGGATTGTCTGACTATCTTATAATG3620873AATGTTGTCAATGAAATGATGATGGCTGCAGGCGCGTATAAATTA
Cmo_Chr13
position: 3857393-3857407
ATTGATGGATTGTCTGACTATCTTATAATG3857393AATGTTGTCAATGAAATGATGATGGCTGCAGGCGCGTATAAATTA
Cmo_Chr15
position: 6665157-6665171
ATCGATGGATTGTCTGACTATCTGATAATG6665157AATGTTGTCAATGAAATGATGATGGTCGCAGGCGCGTATAAATTA
Cmo_Chr17
position: 4863321-4863335
ATCGATGGATTGTCTGACTATCTGATAATG4863321AATGTTGTCAATGAAATGGTGATGGCGTAGGCGCGTATAAATTAC
Cmo_Chr20
position: 8279477-8279491
ATCGATGGATTGTCTGACTATCTGATAATG8279477AATGTTGTCAATGAAATGATGATGGCTGCAGGCGCGTATAAATTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Cmo_v1/TTCATTGACAACATT
lang : en | db : Cmo_v1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.072 | search_plus_done; http://172.18.8.72:28207/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.091 | 0.012 | search_minus_done; http://172.18.8.72:28207/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=36
0.098 | 0.007 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).