GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-09-17 00:15:45, GGGenome : Cucurbita pepo subsp. pepo (Zucchini) genome, v4.1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Cp4.1LG09
position: 2016069-2016083
CGTGATGCTGAAGGGCAAGACGTGCTTCTC2016069TTCATTGACAACATTTTCCGTTTTACCCAGGTAAGCTTGCCTACC
Cp4.1LG17
position: 3424906-3424920
GCAATACTCTAGGAGATGAATTCTTTGCCT3424906TTCATTGACAACATTGTGTTTTGAAAATAGTAGCATGTAGATGGC
Cp4.1LG20
position: 5801103-5801117
TAATTTATACGCGCCTGCGGCCATCATCAT5801103TTCATTGACAACATTCATTATCAGATAGTTGGACAATCCATCGAT
Cp4.1LG00
position: 12061145-12061159
CGTGATGCTGAAGGACAGGATGTGCTTCTC12061145TTCATTGACAACATTTTCCGCTTTACCCAGGTAAATTTTCTAGAA
Cp4.1LG00
position: 13261186-13261200
TAATTTATACGCACCTGCGGCCATCATCAT13261186TTCATTGACAACATTCATTATCAGATAGTCAGACAATCCATCGAT
Cp4.1LG00
position: 13407208-13407222
TAATTTATACGCCCCTGCGGTCATCATCAT13407208TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATCGAT
Cp4.1LG00
position: 13419536-13419550
TAATTTATACGCGCCTGCGGCCATCATCAT13419536TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATCGAT
Cp4.1LG00
position: 13469388-13469402
TAATTTATACGCACCTACGGCCATCATCAT13469388TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATTGAT
Cp4.1LG00
position: 14723201-14723215
AAGGAATGTCTAGACATGTTCGTGATCGTG14723201TTCATTGACAACATTCTAATATACTAAAAAACAGACCTAGAGCAC
Cp4.1LG00
position: 19555353-19555367
TAATTTATACGCGTCTGCGGCCATCATCAT19555353TTCATTGACAACATTCATTATTTTATAGTCAGACAATCAATCGAT
Cp4.1LG00
position: 21557364-21557378
TATTTTATACGCGCCTACAGCAATCATCAT21557364TTCATTGACAACATTCATTATCAGATAGTCGGACAAACCATCGAT
Cp4.1LG00
position: 21570371-21570385
TAATTTATACGCGCCTGCGACCATCATCAT21570371TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATCGAT
Cp4.1LG00
position: 28046085-28046099
TAATTTATACGCGCCTGCAGCCATCATCAT28046085TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATCGAT
Cp4.1LG00
position: 28910412-28910426
TAATTTATACGCGCCTGCGGCCATCATCAT28910412TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATCGAT
Cp4.1LG00
position: 29340847-29340861
TAATTTATACGCGCCTGCGGCCATCATCAT29340847TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATCGAT
Cp4.1LG00
position: 29742225-29742239
TAATTTATACGCGCCTGCGGCCATCATCAT29742225TTCATTGACAACATTCATTATNNNNNNNNNNNNNNNNNNNNNNNN
Cp4.1LG00
position: 30203060-30203074
TAATTTATACGCGCCTGCGGCCATCATCAT30203060TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATCGAT
Cp4.1LG00
position: 36418559-36418573
TAATTTATACGCGCCTGCGGCCATCATCAT36418559TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATCGAT
Cp4.1LG00
position: 40059225-40059239
TAATTTATACACGCCTGCGGCCATCATCAT40059225TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATCGAT
Cp4.1LG00
position: 41043467-41043481
TAATTTATATGCGCCTGCGGCCATCATCAT41043467TTCATTGACAACATTCATTATCAGATAGTCGGACAATCCATCGAT
Cp4.1LG00
position: 43170970-43170984
TAATTTATACGCGCCTGCGGCCATCATCAT43170970TTCATTGACAACATTCATTTTCAGATAGTCGGACAATCCANGGCG
Cp4.1LG00
position: 46015210-46015224
TAATTTATACGCGTCTGCGGCCATCATCAT46015210TTCATTGACAACATTCATTATCAGAAAGTCGGACAATCCATCGAT
Cp4.1LG00
position: 47678599-47678613
ATGGTCAGATTTATGGCCCTGTAATTNTAT47678599TTCATTGACAACATTCATTATCAGATGGTCGGACAATTCATTGAT
Cp4.1LG11
position: 9343723-9343737
CCTCTCCAACCGATGCTGGATCTCATAAAA9343723AATGTTGTCAATGAAAATCTTTTGTTCGGGTAGTAGCCCTTATGG
Cp4.1LG16
position: 600876-600890
ATCGATGGATTGTCCGACTATCTGATAATG600876AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG17
position: 3723821-3723835
ATCGATGGATTGTCTAACTATCTGATAATG3723821AATGTTGTCAATGAAATGATGATGGCCGCAAGTGCGTATAAATTA
Cp4.1LG20
position: 5151257-5151271
ATCGATGGACTATCAGACTGTTTGATAATG5151257AATGTTGTCAATGAAATGATGATCGCTGCTGGTGCGTATAAAATA
Cp4.1LG00
position: 2502409-2502423
ATCAATGGATTGTCCGACTATCAAATAATG2502409AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 2514206-2514220
ATCGATTGATTGTCCGACTATCAAATAATG2514206AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 2515747-2515761
ATCGATTGATTGTCCGACTATCAAATAATG2515747AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 2526020-2526034
ATCGATGGATTGTCCGACTATCAGATAATG2526020AATGTTGTCAATGAAATGATGACGGCTGCAGGCGCATATAAATTA
Cp4.1LG00
position: 2535826-2535840
TTTATAGCCCCATAATCCGACCATCAAATG2535826AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 2542281-2542295
ATCGATTGATTATCCGACTATCAAATAATG2542281AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 13090477-13090491
ATCGATGGATTGTCCGACTATCTGATAATG13090477AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 13151822-13151836
ATCGATGGATTGTTCGACTATTTGATAATG13151822AATGTTGTCAATGAAATGATGATGACCGCAAGCGCGTATAAATTA
Cp4.1LG00
position: 13615740-13615754
ATCGATGGATTGTCCGACTATCTGATAATG13615740AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 13622047-13622061
ATCGATGGATTGTCCGACTATCTGATAATG13622047AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 15274067-15274081
ATCGATGGATTGTCCGACTATCTAATAATG15274067AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 15318433-15318447
ATCAATGGATTGTCCGACTATCTGATAATG15318433AATGTTGTCAATGAAATGATGATGGCCACAGGCGCGTATAAATTA
Cp4.1LG00
position: 18772995-18773009
ATCAATGGATTATCCGACTATCTAATAATG18772995AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 22777074-22777088
ATCGATTGATTATCCGACTATCAAATAATG22777074AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 23901780-23901794
ATCGATGGATTGTCCGACTATCTGATAATG23901780AATGTTGTCAATGAAATGATGATGGCCGCAGGCGTGTATTAAATT
Cp4.1LG00
position: 23915255-23915269
ATCGATTGATTATCCAATTATCAAATAATG23915255AATGTTGTCAATGAAATGATGATGGCCGAAGGCACGTATAAATTA
Cp4.1LG00
position: 25195737-25195751
TCTTTTTCGGATATTCANGATCTAATAATG25195737AATGTTGTCAATGAAATGATGATGGTCGCAGGCGNNNNNNNNNNN
Cp4.1LG00
position: 25660160-25660174
ATCGATTGATTATCTGACTATCAAATAATG25660160AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 25674474-25674488
ATCGATTGATTGTCTGACTATCAAATAATG25674474AATGTTGTCAATGAAATGATGATGGCCGCAGGCGCGTATAAATTA
Cp4.1LG00
position: 25838111-25838125
ATCGATGGATTGTCCGACTATCTGATAATG25838111AATGTTGTCAATGAAATGATGATGGCCGAAGACGCGTATAAATTA
Cp4.1LG00
position: 26550993-26551007
ATCGATGGTTTGTTCGACTATCTGATAATG26550993AATGTTGTCAATGAAATGATGATTGCTGGAGGCGCGTATAAAATA
Cp4.1LG00
position: 28216578-28216592
ATCGATGGATTGTCCGACTATCTGATAATG28216578AATGTTGTCAATGAAATGATGATGGCCGCAGGCGTGTATAAATTA
Cp4.1LG00
position: 31988791-31988805
ATCAATGGATTGTCCGACTATCTGATAATG31988791AATGTTGTCAATGAAATGATGATGGTCGCAGGCGCGTATAAATTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Cp4.1/TTCATTGACAACATT
lang : en | db : Cp4.1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.072 | search_plus_done; http://172.18.8.72:28213/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.097 | 0.018 | search_minus_done; http://172.18.8.72:28213/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=27
0.112 | 0.015 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).