GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-08-14 23:20:50, GGGenome : Carica papaya genome, ASGPBv0.4

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

supercontig_34:309640-309654
GTATTACCTTTTCTTCCTTTTTAGCCATTC309640TTCATTGACAACATTTGGCTTGAAGAAGGCAGAAGATGCAAAATC
supercontig_34:334726-334740
GTATTACCTTTTCTTCCTTTTTAGCCGTTC334726TTCATTGACAACATTTGGCATGAAGAAGGCAGAAGATGCAAAATC
supercontig_21:2160960-2160974
AGGCTTTGATAGTTTTTAATTGATTGTTTG2160960AATGTTGTCAATGAAGGTCCAGATTAGAAGGAAAAAAAAATCTAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Cpapaya_r.Dec2008/TTCATTGACAACATT
lang : en | db : Cpapaya_r.Dec2008 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.74:28293/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.005 | search_minus_done; http://172.18.8.74:28293/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.084 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).