GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 09:42:23, GGGenome : Culex quinquefasciatus genome, CpipJ2 (Jan, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

supercont3.118 dna:supercontig supercontig:CpipJ2:supercont3.118:1:908653:1
position: 646604-646618
CGTGACCAGGAGGGACAGGACGTGCTGCTG646604TTCATTGACAACATTTTCCGCTTCACCCAGGCCGGTTCGGAGGTG
supercont3.12 dna:supercontig supercontig:CpipJ2:supercont3.12:1:1895535:1
position: 844713-844727
AACCGGGGTTTTGGAGGTTAGAATTTCGTG844713TTCATTGACAACATTGAAGGAAAGGGGGCGAGAACTACAGGGTAG
supercont3.4 dna:supercontig supercontig:CpipJ2:supercont3.4:1:2511003:1
position: 738745-738759
AAATCTAGCTACGAGCCATTAAAACGATTT738745TTCATTGACAACATTTCATTGAACATAGTGTTGAAAAATACATTT
supercont3.1343 dna:supercontig supercontig:CpipJ2:supercont3.1343:1:82086:1
position: 61594-61608
GAAATGTTTTGATTGTGAGAAAAAATCGGA61594AATGTTGTCAATGAAAATCAATAAAATAAAAAAAAACAAATAAAA
supercont3.484 dna:supercontig supercontig:CpipJ2:supercont3.484:1:409395:1
position: 334297-334311
AATGATATTCAATTTGTTCGGAGAACTTGC334297AATGTTGTCAATGAATCAGCACGGTGAGATGAAGTCATAGTTTGT
supercont3.141 dna:supercontig supercontig:CpipJ2:supercont3.141:1:788774:1
position: 623221-623235
TCGCCTTTTTCAAAATGAAGAGAAGTTATG623221AATGTTGTCAATGAACATGTAGTTTTTATGTCGATGCTTTCTTTC
supercont3.110 dna:supercontig supercontig:CpipJ2:supercont3.110:1:902770:1
position: 259253-259267
CACATGCTAATTGCATTATGAAAACCTTAA259253AATGTTGTCAATGAATATAGCGTATTCCTGGATCAATACAAATAC
supercont3.15 dna:supercontig supercontig:CpipJ2:supercont3.15:1:1741670:1
position: 650044-650058
AAATTAATATTTAGTGGAAATTTAGATTAG650044AATGTTGTCAATGAATTATAATTAATTAGGAGCGCTTTTAAGCAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/CpipJ2/TTCATTGACAACATT
lang : en | db : CpipJ2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.081 | 0.073 | search_plus_done; http://172.18.8.76:28140/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.006 | search_minus_done; http://172.18.8.76:28140/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.090 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).