GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-04-13 21:56:51, GGGenome : Cucumis sativus genome, v1.0

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold02633 length=1101566:503627-503641
TTTTGGCATATTTACCTGGGTAAAGCGGAA503627AATGTTGTCAATGAAGAGAAGCACATCCTGTCCTTCAGCATCACG
scaffold00934 length=998311:15420-15434
CAAATAATACCAAAATGTAGAAGATTAAAC15420TTCATTGACAACATTTACAAATCATCTCTTCTAGTTTTTAAACAT
scaffold01543 length=1845703:951329-951343
AGTTCTATTCTTTTCAATAGCATTTATTTC951329TTCATTGACAACATTCTTCCATCCAGGACACTCTAAAGTAGTGTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Csativus_v1/AATGTTGTCAATGAA
lang : en | db : Csativus_v1 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.077 | 0.069 | search_plus_done; http://172.18.8.74:28297/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.080 | 0.004 | search_minus_done; http://172.18.8.74:28297/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=49
0.081 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).