GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-09-17 01:15:56, GGGenome : Citrus sinensis genome, v1.1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold00211 length=271322:42612-42626
AAAGACTACCTAGACAAATTCATAGTGGTG42612TTCATTGACAACATTTTGATCTACTCACAAACAAAGAGCATGTTG
scaffold00632 length=94237:41331-41345
AGAACCAAAGCAAAAATGAAAGGTTTCTTC41331TTCATTGACAACATTGCCATTTCCACTCTTATTATTTCTCTTACA
scaffold01798 length=18971:14612-14626
AGAACCAAAGCAAAAATGAAACATTTCTTC14612TTCATTGACAACATTGCCATTTCCATTCTCATTATTTCTCTTAAA
scaffold00005 length=2991484:1771777-1771791
TTTAAGAGAAATAATGAGAGTGGAAATGGC1771777AATGTTGTCAATGAAGAAGAAATGTTTCATTTTTGCTTTGGTTCT
scaffold00006 length=2902706:2852698-2852712
TTGATCACTTTGCGACTGATTTGACATAAA2852698AATGTTGTCAATGAACATCGTTGGTGTCGTTTTCCAACGATTGTA
scaffold00125 length=419460:381165-381179
TGTAAGAGAAATAATAAGAGTGGAAATGGC381165AATGTTGTCAATGAAGAAGAAATGTTTCATATTTGCTTTGGTTCT
scaffold00283 length=218217:107442-107456
TGTAAGAGAAATAATAAGAGTGGAAATGGC107442AATGTTGTCAATGAAGAAGAAACCTTTAANNNNNNNNNNNNNNNN
scaffold00283 length=218217:111833-111847
TGTAAGAGAAATAATAAGAGTGGAAATGGT111833AATGTTGTCAATGAAGAAGAAACCTTTAATTTTTGCTTTGGTTCT
scaffold01533 length=22892:9028-9042
GTGCTCTTCCTTTGCTCGTGAGTAGACCAA9028AATGTTGTCAATGAACACCACTATGAATTTGTCTAGGTAATCTTT
scaffold02174 length=15094:4163-4177
ATACCTTAGGATTAGACTTTGCAAATGGCA4163AATGTTGTCAATGAAGTGTCCCGTAACAACCATGCAACCTTTCTT
scaffold05281 length=4439:3321-3335
TGTAAGAGAAATAATAAGAGTGGAAATGGC3321AATGTTGTCAATGAAGAAGAAACCTTTCATTTTTGCTTTGGTTCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Csinensis_v1/TTCATTGACAACATT
lang : en | db : Csinensis_v1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.072 | search_plus_done; http://172.18.8.74:28295/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.006 | search_minus_done; http://172.18.8.74:28295/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.089 | 0.004 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).