GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-08 05:56:10, GGGenome : Danaus plexippus genome, DanPle_1.0 (Nov, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH382258 dna:supercontig supercontig:DanPle_1.0:JH382258:1:28418:1
position: 3807-3821
ACTTGCTTCCTTTTTCAATTCCGATGACTG3807TTCATTGACAACATTTTCTACAAGTGTTGGTATAAGATCATTCCA
JH384967 dna:supercontig supercontig:DanPle_1.0:JH384967:1:122213:1
position: 85719-85733
GCTGCTCTACACCACCGAGGAGCACGGCTG85719TTCATTGACAACATTCTACGTCAGAGTGGAACACCATGAGCCAAC
JH383009 dna:supercontig supercontig:DanPle_1.0:JH383009:1:500659:1
position: 170342-170356
GTGCTATTTTAATAAAATATATAAATTTTG170342TTCATTGACAACATTAGAGAAACTTATTCGTAAATTATTTCAATA
JH388368 dna:supercontig supercontig:DanPle_1.0:JH388368:1:12484:1
position: 1260-1274
AATATGTATTTTAAACAGTCATTAATGATT1260AATGTTGTCAATGAAGTGAATAAATGATTTGAATCGTAACTCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/DanPle_1.0/TTCATTGACAACATT
lang : en | db : DanPle_1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.205 | 0.197 | search_plus_done; http://172.18.8.76:28141/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.216 | 0.011 | search_minus_done; http://172.18.8.76:28141/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.216 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).