GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-09-17 01:04:56, GGGenome : Daphnia pulex genome, V1.0 (Feb, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

DAPPUscaffold_357 dna:supercontig supercontig:GCA_000187875.1:DAPPUscaffold_357:1:57784:1
position: 29210-29224
CTGCTCTCAAATTACTTATAAACTAATTTT29210TTCATTGACAACATTACACGCGCTTAGACTTAATTAAGCTATAGC
DAPPUscaffold_170 dna:supercontig supercontig:GCA_000187875.1:DAPPUscaffold_170:1:247021:1
position: 103026-103040
TGCTCTCAAATTACTTATCAACTAATTTTT103026TTCATTGACAACATTACACGCGCTATAGTGATTACTTCCCTCAAG
DAPPUscaffold_1 dna:supercontig supercontig:GCA_000187875.1:DAPPUscaffold_1:1:4193030:1
position: 1987191-1987205
CGTGACCAGGAAGGCCAAGATGTGTTGCTC1987191TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCTGAGGTG
DAPPUscaffold_1171 dna:supercontig supercontig:GCA_000187875.1:DAPPUscaffold_1171:1:11156:1
position: 7812-7826
CTACTAATAAATAACGGTACAATTATAGGA7812AATGTTGTCAATGAAAATCTGTTTAACATTCATTAACATGAAGTT
DAPPUscaffold_54 dna:supercontig supercontig:GCA_000187875.1:DAPPUscaffold_54:1:841328:1
position: 761089-761103
CAGAAAGCAATTCTACATGGTTGAAAGTAA761089AATGTTGTCAATGAAATATTAATATCTTGACAGGTGGGGGAAAAA
DAPPUscaffold_28 dna:supercontig supercontig:GCA_000187875.1:DAPPUscaffold_28:1:1197646:1
position: 132935-132949
CTACTAATAAATAACGGTACAATTATAGGA132935AATGTTGTCAATGAAAATCTGTTTAACATTCATTAACATGAAGTT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Dappu_V1.0/TTCATTGACAACATT
lang : en | db : Dappu_V1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.073 | search_plus_done; http://172.18.8.76:28142/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.005 | search_minus_done; http://172.18.8.76:28142/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.087 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).