GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-05-24 03:51:12, GGGenome : Dendroctonus ponderosae genome, DendPond_male_1.0 (Apr, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Seq_1102764 dna:supercontig supercontig:GCA_000355655.1:Seq_1102764:1:669493:1
position: 489644-489658
AAGCCAAAACCTCTCTATTTGTTCTCTCGG489644AATGTTGTCAATGAAGTCAATGAGAAATTTAAAAAAAATTATATA
Seq_1102959 dna:supercontig supercontig:GCA_000355655.1:Seq_1102959:1:1912037:1
position: 1854230-1854244
TTTTCCAATGCAATGTTTGGCTATTCCAAA1854230AATGTTGTCAATGAAATCTTGGAGTATTTTACAAGAATTATTTAC
Seq_1101809 dna:supercontig supercontig:GCA_000355655.1:Seq_1101809:1:346276:1
position: 230420-230434
GAAGGATGTCGTTATCATTTGAAAAAAATA230420TTCATTGACAACATTACAATGTTTATGTTTTATAAATATGGTGAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/DendPond_1.0/AATGTTGTCAATGAA
lang : en | db : DendPond_1.0 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.079 | 0.070 | search_plus_done; http://172.18.8.76:28143/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.005 | search_minus_done; http://172.18.8.76:28143/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=48
0.084 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).