GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 12:28:03, GGGenome : Flycatcher genome, FicAlb_1.4 (Jan, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH603182.1 dna:scaffold scaffold:FicAlb_1.4:JH603182.1:1:15162140:1 REF
position: 14614204-14614218
ATTCATTTTATAGTGTGAGCCTGTGCTCTC14614204TTCATTGACAACATTTTGAAACACTTTGTGGACATACCCACATTT
JH603183.1 dna:scaffold scaffold:FicAlb_1.4:JH603183.1:1:15005869:1 REF
position: 7361312-7361326
GAAAACAGAGCTCTTCATTTTGCAAGGTGT7361312TTCATTGACAACATTTCTGCAGGCTGGAATAGTAACAGAAGGAAT
JH603185.1 dna:scaffold scaffold:FicAlb_1.4:JH603185.1:1:14156676:1 REF
position: 8689974-8689988
CCTAAAAAATCCTCCTCCTATAGTAGATTT8689974TTCATTGACAACATTGAGATAACCACAGTCTTTTTCCATTGTCAA
JH603255.1 dna:scaffold scaffold:FicAlb_1.4:JH603255.1:1:3807728:1 REF
position: 2883767-2883781
AAAAAGTATAATATTCAGGAAAGCTGAAAC2883767TTCATTGACAACATTTCTGAGATTTCTCTCCACATGCTTTAAATA
JH603220.1 dna:scaffold scaffold:FicAlb_1.4:JH603220.1:1:6718841:1 REF
position: 5068664-5068678
TATGAGTTGTTCATCTGTAAATAATAAGTG5068664AATGTTGTCAATGAATAGGTCAAAAAATTTTATTTACAAATGAGT
JH603222.1 dna:scaffold scaffold:FicAlb_1.4:JH603222.1:1:6542656:1 REF
position: 6250462-6250476
TCTTGGCACTGCAATGACTGCCCATGTATA6250462AATGTTGTCAATGAAATTTTTAACTGAGTTTGCTGTAATGAAAAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/FicAlb_1.4/TTCATTGACAACATT
lang : en | db : FicAlb_1.4 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.100 | 0.093 | search_plus_done; http://172.18.8.76:28124/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.112 | 0.012 | search_minus_done; http://172.18.8.76:28124/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.113 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).