GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-01-18 16:09:04, GGGenome : Paroedura picta genome, Ppicta_v2.0 (Sep, 2021)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

BDOT02000002.1 Paroedura picta DNA, hic_parpi00000002, whole genome shotgun sequence
position: 137817551-137817565
CATGCTACCAGGATTGTTGAAGTCCCATAA137817551TTCATTGACAACATTTGAATACGGTCTGTTCATTTTAATTGAATA
BDOT02000003.1 Paroedura picta DNA, hic_parpi00000003, whole genome shotgun sequence
position: 139058043-139058057
TTCCCATTGGCACCTTTCCTTTAAATGAGA139058043TTCATTGACAACATTTTCATTGCCTGCACCCATGGCAAAGTCCTC
BDOT02000005.1 Paroedura picta DNA, hic_parpi00000005, whole genome shotgun sequence
position: 52469128-52469142
AGTTCTCTCTCAGCACTGCAGACGCTGTCC52469128TTCATTGACAACATTATTTCCTCAGGTGCTATGCACTTCTGCTTG
BDOT02000009.1 Paroedura picta DNA, hic_parpi00000009, whole genome shotgun sequence
position: 53437256-53437270
AATTCCATTTGCAATAATAGGATTAAATTT53437256TTCATTGACAACATTTATATTTCTCCTTCCTGCCAGTTAGAGCTA
BDOT02000010.1 Paroedura picta DNA, hic_parpi00000010, whole genome shotgun sequence
position: 19439761-19439775
AAGGACATAACATATGCAAGTTATGTGCAA19439761TTCATTGACAACATTGTCTTTACAAAACAATTACCCCACTATTTT
BDOT02000012.1 Paroedura picta DNA, hic_parpi00000012, whole genome shotgun sequence
position: 48952291-48952305
CACCCACTCACATCTCTCGTATGCCTGCGA48952291TTCATTGACAACATTTTAATCGTCTGGACACATGGTAAAGAAGCC
BDOT02000001.1 Paroedura picta DNA, hic_parpi00000001, whole genome shotgun sequence
position: 50029132-50029146
ATCTCCTGTTTTGTTAAGAACTGTTTATTT50029132AATGTTGTCAATGAAAGATTCCAGTCCTCTGAGCTCATGTTTACA
BDOT02000005.1 Paroedura picta DNA, hic_parpi00000005, whole genome shotgun sequence
position: 41031222-41031236
CTTTTATCCACTTACCAACCACAAGTATGC41031222AATGTTGTCAATGAATGCTTCCATAAATTCAGACAAAAACAGTAG
BDOT02000014.1 Paroedura picta DNA, hic_parpi00000014, whole genome shotgun sequence
position: 5376130-5376144
AAATAAAATAAAATAAAATAAAATAAAATA5376130AATGTTGTCAATGAAGCAACGGAAGGCCTGTGCTGAGGGCTTCGG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/GCA_003118565.2/TTCATTGACAACATT
lang : en | db : GCA_003118565.2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.080 | 0.073 | search_plus_done; http://172.18.8.72:28887/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.088 | 0.007 | search_minus_done; http://172.18.8.72:28887/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.090 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).