GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-11-29 11:53:53, GGGenome : Bicyclus anynana genome, Bicyclus_anynana_v1.2 (Jan, 2018)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

NW_019863126.1 Bicyclus anynana unplaced genomic scaffold, Bicyclus_anynana_v1.2 BANY00379, whole genome shotgun sequence
position: 208745-208759
TTATAGCAGTATTTATAGTATAATATAAAT208745AATGTTGTCAATGAATCCAGCGAGAAATGTGACGCTTAGTACAGC
NW_019862811.1 Bicyclus anynana unplaced genomic scaffold, Bicyclus_anynana_v1.2 BANY00064, whole genome shotgun sequence
position: 862180-862194
ACTGAAACGCGGGAATTTTGAGTTGATAAT862180TTCATTGACAACATTGATTGCAGTTATTTTAATATATATGTTCTG
NW_019862811.1 Bicyclus anynana unplaced genomic scaffold, Bicyclus_anynana_v1.2 BANY00064, whole genome shotgun sequence
position: 865689-865703
ACTGAAGCGCGAGAAGTTTGAATTGATTAT865689TTCATTGACAACATTTATAGTAGTTGTTTTATTATATGTATATTG
NW_019862811.1 Bicyclus anynana unplaced genomic scaffold, Bicyclus_anynana_v1.2 BANY00064, whole genome shotgun sequence
position: 869358-869372
AATAAAGCGTGGAAAGTTTGAATTAATAAT869358TTCATTGACAACATTTGTTGTAGTTATTTTGATGTATATGTTCTG
NW_019862866.1 Bicyclus anynana unplaced genomic scaffold, Bicyclus_anynana_v1.2 BANY00119, whole genome shotgun sequence
position: 546135-546149
ATTAATTTAAGCACAGATAAACAACGGTAT546135TTCATTGACAACATTTAACGATGAATAACATTTTGACTCCGGTTA
NW_019862981.1 Bicyclus anynana unplaced genomic scaffold, Bicyclus_anynana_v1.2 BANY00234, whole genome shotgun sequence
position: 73519-73533
ATCATTTATATATGCAATGTTTTCCACATT73519TTCATTGACAACATTTGCTGTAGCAACTATTAGCCTGTTCAGTGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/GCF_900239965.1/AATGTTGTCAATGAA
lang : en | db : GCF_900239965.1 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.72:28850/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.004 | search_minus_done; http://172.18.8.72:28850/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=49
0.085 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).