GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-05 13:16:59, GGGenome : Takifugu rubripes genome, fTakRub1.2 (Jun, 2019)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

NC_042297.1 Takifugu rubripes chromosome 13, fTakRub1.2, whole genome shotgun sequence
position: 5541261-5541275
TTGTAGTAAAATTATTTTCCCCTTAAACCA5541261AATGTTGTCAATGAAGAAATGGGCTATCCTTATGAATATTTGTAC
NC_042290.1 Takifugu rubripes chromosome 6, fTakRub1.2, whole genome shotgun sequence
position: 2918971-2918985
GATTTAAAAATATATATATTTATTTTTTAC2918971TTCATTGACAACATTGTCTTAGTTGTGACTGATTAATACTATGAT
NC_042294.1 Takifugu rubripes chromosome 10, fTakRub1.2, whole genome shotgun sequence
position: 5132124-5132138
TATATTTTTATAATACAGATTATAATTCTT5132124TTCATTGACAACATTTCATTTTCTATTCAAAGTGGATTTTTTCAC
NC_042303.1 Takifugu rubripes chromosome 19, fTakRub1.2, whole genome shotgun sequence
position: 5646396-5646410
ACCTCTCACTCGCCACACTAGTTAAGTTTT5646396TTCATTGACAACATTGATTTCCAAGCCATCCGAATTTTTGTTTGT
NC_042306.1 Takifugu rubripes chromosome 22, fTakRub1.2, whole genome shotgun sequence
position: 14530880-14530894
TGCCACTGTTCTTTTACTGGACCACTGCAG14530880TTCATTGACAACATTAAATATCCCATACATGATTTAAAGACTATT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/GCF_901000725.2/AATGTTGTCAATGAA
lang : en | db : GCF_901000725.2 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.070 | search_plus_done; http://172.18.8.72:28874/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.005 | search_minus_done; http://172.18.8.72:28874/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=49
0.084 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).