GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 10:33:57, GGGenome : Glycine max genome, Wm82.a2.v1/v2.0 Phytozome Gmax_275

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr01:25668425-25668439
TTGGATCAATTTGAGCCATTTATACAGGGT25668425TTCATTGACAACATTGTGGATGTGAAAGCAGACAACAATTGTGGA
Chr02:8356198-8356212
GTGGATCAATTTCATCCTGTTATACACGAT8356198TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
Chr03:2400240-2400254
TTCGATCAATTACATTCATTTATACACAAT2400240TTCATTGACAACATTGTGGATGTCAAAGCTGATAGTAACTGTGGA
Chr03:11526542-11526556
TTGGATCAATTTCAACCATTTATACACAAT11526542TTCATTGACAACATTGTAGATGCCAAAACTGACAGTAACTGTGGA
Chr04:6988352-6988366
TTGGATCAATTTCATCCGTTTATACATGAT6988352TTCATTGACAACATTGTGGATGCCAAAGCTGACGGTAACTGTGGA
Chr04:8305503-8305517
TTGGATCAATTTCATCCGTTTATACATGAT8305503TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
Chr04:11353738-11353752
TCATTCCAAAATTGAAAACATTTAAGGAAG11353738TTCATTGACAACATTTGATGAAGTGGCAACATGTGAAACAAACAT
Chr04:22858846-22858860
TTGGATCAATTTCATTTGTTTATACATGAT22858846TTCATTGACAACATTGTGGATGTCAAAGCTGACGATAACTGTGGA
Chr04:36052810-36052824
TTGGATCAATTTCAGCCATTTATACACGAC36052810TTCATTGACAACATTATGGATGTCAAAGCTTATAGTAACTGTGGA
Chr06:18260842-18260856
TTAGATCAATTTTAGCCATTTATACACGAT18260842TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
Chr06:20887685-20887699
TTAGATCAATTTGAGCCATTTATACAGGGT20887685TTCATTGACAACATTGTGGATGTGGTAGCGGACGGTAACTGTGGA
Chr07:28729079-28729093
TTGGATCAATTTCAGCCATTTATACACGAT28729079TTCATTGACAACATTGTGGATGTCAAAGCTGACAGTAACTTTTTA
Chr07:31539506-31539520
TTGGATTAATTTGAGCCATTTATACAGGGT31539506TTCATTGACAACATTGTGGATGTGAAAGCAGATGATAACTGTAGA
Chr08:30785779-30785793
TTGGATCAATTTTAGTCGTTTATACACGAT30785779TTCATTGACAACATTGTGGATGTCAAAGCTGAAGGTAACCATGGA
Chr08:33370702-33370716
TTGGATCAGTTTCATCCATTTATACACGAT33370702TTCATTGACAACATTGTGGATGTCAAAGTTGACGGTAACTGTAAA
Chr10:34099820-34099834
TTGGATCAATTTCAGCCATTTATACACGAT34099820TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
Chr10:39867646-39867660
TTGGATCAATTTCATCTGTTTATACACGAT39867646TTCATTGACAACATTGTGGATGTCAAAGCTAACGGTAACTGTGGA
Chr12:12844569-12844583
TTGGATCAATTTGAGCCATTTATACAGGGT12844569TTCATTGACAACATTGTGGATGTGAAAGCGGACGGTAATTGAAGA
Chr12:36911425-36911439
AGGAAGAGTGTAAGGGAAGGAAAAAATAAA36911425TTCATTGACAACATTTTTCTAGTTTGAGTACCCTGTTTAGTAAAG
Chr13:10798744-10798758
TTGGATCAATTTCAGCCATTTATCCACGAC10798744TTCATTGACAACATTATTGATGTCAAAGCTGATAAAAACTGTGGA
Chr13:13318076-13318090
TTGGATCAATTTCAGCGATTTTTCCACGAC13318076TTCATTGACAACATTGTGGATGTCAAAGCTGATGGAAACTGTGGA
Chr14:42247076-42247090
TTGGATCAATTTGAACCATTTATACAGGGT42247076TTCATTGACAACATTGTGGATGTGAAAGCGGACGGTAATTGTGGA
Chr16:14528752-14528766
TTGGATCAATTTCAGTCATTTATCCACGAC14528752TTCATTGACAACATTGTGGATGTCAAAGCTGACGGAAACTGTGGA
Chr16:14816284-14816298
TTGGATCAATTTCAACCGTTTATACACGAT14816284TTCATTGACAACATTGTGGATGTCAAAGCTGACGATAACTGTGGA
Chr18:17033260-17033274
TTTTAGCTCACTAACTATTGAATTTCTCAG17033260TTCATTGACAACATTTGTCCTATCAAGTCATTCTATCAAACTTAA
Chr18:47313598-47313612
AACAATAATAGGAGTACAACTAAGTCAAAA47313598TTCATTGACAACATTCTAGTTGTTGAGGAAAGAGTTCAGAATAGG
Chr19:24137417-24137431
TTGGATTAATTTGAGCCATTTATACAGGGT24137417TTCATTGACAACATTGTGGATGTGAAAGCGGATGGTAATTGTGGA
Chr19:33688652-33688666
TTGGATCAATTTGAGCCATTTATACAAGGT33688652TTCATTGACAACATTGTGGATGTGAAAGCTAACGGTAACTGTGGA
Chr19:35872429-35872443
TTGGATCAATTTCAGCCATTTATCCACGAT35872429TTCATTGACAACATTGTCAATGTCAAAGCTGACGAAAACTGTGGA
Chr01:6345964-6345978
TTCACAATTACCGTCAGCTTTCACATTCAC6345964AATGTTGTCAATGAAACCCTGTATAAATGGCTCAAATTGATCCAA
Chr01:8007766-8007780
TCCATAGTTTCCGTCAGCTTTGACATCCAC8007766AATGTTGTCAATGAAATCGTGGATAAATGGCTGAATTGATCCAAC
Chr01:14752215-14752229
TCCACAGTTATTGTCAGCTTTGACATCCAC14752215AATGTTGTCAATGAAATCATGTATAAATGGATGAAATTGATCCAA
Chr01:43047626-43047640
TCCATAGTTTCCGTCAGGTTTGACATCCAC43047626AATGTTGTCAATGAAATCTTGCATAAATGGCTGAAATTGATCCAA
Chr02:23914118-23914132
TCCATAGTTACCATATGCTTTCACATCCAC23914118AATGTTGTCAATGAAATCCTGTATAAATGGCTCAAATTGATGCAC
Chr03:23174134-23174148
CCCACAGTTTCTGTTAGCTTTGACATCGAC23174134AATGTTGTCAATGAAATCGTGGATAAATGGCTAAAATTGATCCAA
Chr04:8282839-8282853
TCCATAGTTACCATCCGCTTTCACATCCAT8282839AATGTTGTCAATGAAATCCTGTATAAATTGCTCAAATTGATCCAA
Chr04:9940906-9940920
TCCATAGTTTCCGTCAGGTTTGACATCCAC9940906AATGTTGTCAATGAAATCCTGCATAAATGGCTGAAATTGATCCAA
Chr04:14303116-14303130
TTTTTTACAACATCGATTTTACAAAACATC14303116AATGTTGTCAATGAAGAACAACATTGGTTTTTATTAAAACCGATG
Chr04:20936724-20936738
GCTGGGGTAGATGGCAAACGTTGTCTGGAA20936724AATGTTGTCAATGAAGTTGTGTTGCTTGCTGCTCGTAGAGGTAAC
Chr04:46342266-46342280
TCCACAGTTACCGTCAACTTTGACATCCAC46342266AATGTTGTCAATGAAATCGTGTATAAACGGCTGAAATTGATCCAA
Chr05:20031250-20031264
CCCATAGTTTCCATCAGCTTGGACATCAAT20031250AATGTTGTCAATGAAGTCGTGGATAAATGGCTGAAATTGATCCAA
Chr07:14680829-14680843
TCCACAGTTATCATCCGCTTTCACATCCAC14680829AATGTTGTCAATGAAACCCTATATAAATGGCTCAAATTGATCCAA
Chr07:15138110-15138124
TCCACAGTTACTGTCAGCTTTCACATCCAC15138110AATGTTGTCAATGAAATCCTATATAAATGGCTCAAATTGATCCAA
Chr07:18317747-18317761
TTGAGTTTGAGACAATGATTGGGTAAGCCA18317747AATGTTGTCAATGAATTAAGAAATTCAGTTGTGAGTGAGCGAAAA
Chr07:26359494-26359508
TCCACAGTTACCGTCAGCTTTCACATCCAC26359494AATGTTGTCAATGAAACCCTGTATATAAATGGCTTAAATTGATCC
Chr07:39595393-39595407
TCCACAGTTTCCATCAACTTTGACATCCAC39595393AATGTTGTCAATGAAGTCGTGGATAAATGACTGAAATTGATCCAA
Chr08:19256329-19256343
TCCACAGTTACCATCCGCTTTCACATCCAC19256329AATGTTGTCAATGAAACCTTGTATAAATGACTCAAATTGATCCAA
Chr08:19374567-19374581
TCCATAGTTACCGTCAGCTTTGACATCCAC19374567AATGTTGTCAATGAAATCGTGGATAAATGGTTGAAATTGATCCAA
Chr08:36736624-36736638
TCCATAGTTACCGTCAGCTTTGACATCCAC36736624AATGTTGTCAATGAACTATGCTTCATCGAAGAATTACTATTTTGC
Chr10:8725914-8725928
TCCACAGTTACCATTCGCTTTAACATCCAC8725914AATGTTGTCAATGAAACCCTGTATAAATGGCTCAAATTGATCCAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Gmax_Wm82.a2.v1/TTCATTGACAACATT
lang : en | db : Gmax_Wm82.a2.v1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.090 | 0.083 | search_plus_done; http://172.18.8.74:28791/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.116 | 0.026 | search_minus_done; http://172.18.8.74:28791/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=21
0.125 | 0.009 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).