GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-17 16:38:40, GGGenome : Glycyrrhiza uralensis genome, release 1 (Aug, 2016)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Scaffold00095
position: 191872-191886
AATGTACAGCTATTTACAGATCAACCATCT191872AATGTTGTCAATGAAAGCACTKTTCCCCTTGTTATGGAAAAAATT
Scaffold05586
position: 3659-3673
TTAATTAGTTGTTGGTCATAGCAAGGTAAC3659AATGTTGTCAATGAAAAGTTAGAGACGATGCAGGGTCAAGTTCAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Gur1/AATGTTGTCAATGAA
lang : en | db : Gur1 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.073 | search_plus_done; http://172.18.8.72:28749/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.005 | search_minus_done; http://172.18.8.72:28749/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=48
0.085 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).