GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-04-25 07:57:30, GGGenome : Helobdella robusta genome, Helro1 (Dec, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

HELROscaffold_1 dna:supercontig supercontig:GCA_000326865.1:HELROscaffold_1:1:13640604:1
position: 6665435-6665449
TTTTTACATTAACATCTTTAAACAATGTAA6665435AATGTTGTCAATGAATTATAAAACCACTCAGTCAACCAACTGGTA
HELROscaffold_88 dna:supercontig supercontig:GCA_000326865.1:HELROscaffold_88:1:565942:1
position: 193193-193207
TTTGAATTGGTGTTATCATCTTTAGCGAAA193193TTCATTGACAACATTTTTGTCTACAACGTCAACAACAACATCAAC
HELROscaffold_20 dna:supercontig supercontig:GCA_000326865.1:HELROscaffold_20:1:3090232:1
position: 1054722-1054736
CAACTATGAAGACAAGATAAGACAAGATGT1054722TTCATTGACAACATTGCACCACCATATGTCCTACTTAAAATGCTA
HELROscaffold_15 dna:supercontig supercontig:GCA_000326865.1:HELROscaffold_15:1:4003280:1
position: 501161-501175
GTTTCCACAAGCTTTTTGGAGTTTACTGTT501161TTCATTGACAACATTCTTCCAATATACTTTATGTTTGTTTGAATG
HELROscaffold_8 dna:supercontig supercontig:GCA_000326865.1:HELROscaffold_8:1:5907480:1
position: 4806930-4806944
TACTCACAATTTCTGAATTTCTAATGTTCA4806930TTCATTGACAACATTTTCAGACATACATTGGGCCGGTGTTGATAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Helro1/AATGTTGTCAATGAA
lang : en | db : Helro1 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.081 | 0.072 | search_plus_done; http://172.18.8.76:28146/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.004 | search_minus_done; http://172.18.8.76:28146/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=49
0.087 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).