GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-04-25 08:18:13, GGGenome : Hordeum vulgare genome, 082214v1 (Mar, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

1 dna:chromosome chromosome:082214v1:1:1:464124043:1
position: 152251787-152251801
GCATCCAAATAGGCAGAAACTTAGGAGAAT152251787TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
3 dna:chromosome chromosome:082214v1:3:1:564427874:1
position: 15026981-15026995
CCCATAGTTTTTTAACAACAACATATTTTT15026981TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
3 dna:chromosome chromosome:082214v1:3:1:564427874:1
position: 418615933-418615947
CGCTATGTAATGAGCTCCAACAATATTTTA418615933TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
5 dna:chromosome chromosome:082214v1:5:1:561411686:1
position: 119548036-119548050
TTTGGCTCAGGTTTACCCTCTTGCCTATTT119548036TTCATTGACAACATTTGTCAGTATATCGCTTCTAATTTTACTCAG
4 dna:chromosome chromosome:082214v1:4:1:544168226:1
position: 281534574-281534588
TGATGCACCGCTAAGTGTGCCACCCCCTCC281534574AATGTTGTCAATGAACATTTTGAATGTGTGGCAGGCATGGTCTGA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Horvu_v1/TTCATTGACAACATT
lang : en | db : Horvu_v1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.082 | 0.074 | search_plus_done; http://172.18.8.75:28177/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.088 | 0.006 | search_minus_done; http://172.18.8.75:28177/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.089 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).