GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-04-25 07:32:19, GGGenome : Hydra genome, Hydra_RP_1.0 (Oct, 2009)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

GL021293.1 Hydra magnipapillata strain 105 unplaced genomic scaffold HYDRAscaffold_38084, whole genome shotgun sequence
position: 5826-5840
AGTGTAGTTTTATTGAGTTTTCCAAAATTT5826TTCATTGACAACATTAATTTAAATGATAACCGTTTTCCAAATGGA
GL021758.1 Hydra magnipapillata strain 105 unplaced genomic scaffold HYDRAscaffold_37616, whole genome shotgun sequence
position: 61995-62009
AAATGTGACCTGAAGAATAAAATTTTACCT61995TTCATTGACAACATTGAGCATTGTGGTGGCATATCATTTAATAGA
GL022537.1 Hydra magnipapillata strain 105 unplaced genomic scaffold HYDRAscaffold_36832, whole genome shotgun sequence
position: 28274-28288
TCTACTAGAGTATCACCAAACTCAGCAACT28274TTCATTGACAACATTATTACAACTGATGTCTTCAATAATAATATA
GL023816.1 Hydra magnipapillata strain 105 unplaced genomic scaffold HYDRAscaffold_35550, whole genome shotgun sequence
position: 38794-38808
ATAAAGTAAAATTCATCTGAAAAACAAGAT38794TTCATTGACAACATTGAATTAAGTATAAATTACCACATAAATCCA
GL024105.1 Hydra magnipapillata strain 105 unplaced genomic scaffold HYDRAscaffold_35261, whole genome shotgun sequence
position: 14616-14630
AGTGTAGTTTTTTTGAGAATTAAAAAATAT14616TTCATTGACAACATTAATTTAAATGATAATCTCGAACTAATTTAG
GL025009.1 Hydra magnipapillata strain 105 unplaced genomic scaffold HYDRAscaffold_34353, whole genome shotgun sequence
position: 19436-19450
GTATGTGACCTGAAGAATTAAATTTTACCT19436TTCATTGACAACATTGAGCATCGTGGTGACATATCAATTAATAGA
GL027457.1 Hydra magnipapillata strain 105 unplaced genomic scaffold HYDRAscaffold_31899, whole genome shotgun sequence
position: 16342-16356
GTATGTGACCTGAAGAATTGAATTTTACCT16342TTCATTGACAACATTGAGCATTGTGGTGACATCAATTAATAGAAC
GL028029.1 Hydra magnipapillata strain 105 unplaced genomic scaffold HYDRAscaffold_31325, whole genome shotgun sequence
position: 17542-17556
ATGAAGATTATTACCTCAACTTCAGCTACC17542TTCATTGACAACATTATAACAACCGATATCTTTAATAAAACTCTT
GL020112.1 Hydra magnipapillata strain 105 unplaced genomic scaffold HYDRAscaffold_39267, whole genome shotgun sequence
position: 187219-187233
AGAAATGTCTAACTTGAATTTTAAATCATA187219AATGTTGTCAATGAAACAAATGATTCCAAATAATATTCATCAGTA
GL021748.1 Hydra magnipapillata strain 105 unplaced genomic scaffold HYDRAscaffold_37626, whole genome shotgun sequence
position: 28700-28714
TAAAAACAAATTAATAGTTTTTTTTTTGTA28700AATGTTGTCAATGAAAACCTGTTATTAACTCTGGCGAAATCAGTA
GL030389.1 Hydra magnipapillata strain 105 unplaced genomic scaffold HYDRAscaffold_28961, whole genome shotgun sequence
position: 24-38
AAATCAATAGTTTTTTTTTTATA24AATGTTGTCAATGAAAACCTGTTATTAACCCTGGCGAAATCAGTA
GL034076.1 Hydra magnipapillata strain 105 unplaced genomic scaffold HYDRAscaffold_25265, whole genome shotgun sequence
position: 6724-6738
AGTTGATTAAAGGATTATTTTATACAATAG6724AATGTTGTCAATGAAATAAATATATGTAACCAATTTAACAACATT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Hydra_RP_1.0/TTCATTGACAACATT
lang : en | db : Hydra_RP_1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.77:28234/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.088 | 0.008 | search_minus_done; http://172.18.8.77:28234/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.090 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).