GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:36:32, GGGenome : Vitis vinifera genome, IGGP_12x (Jun, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

2 dna:chromosome chromosome:IGGP_12x:2:1:18779844:1
position: 12001041-12001055
GCCCTAAGCTCACGAGTCAGAGTCTTTCAT12001041TTCATTGACAACATTAAGTTGTGCATAACTTCTAGAGCCTTGAGC
15 dna:chromosome chromosome:IGGP_12x:15:1:20304914:1
position: 10155767-10155781
TGCCTTTAAATTTATAAAAATAAAATAAAA10155767TTCATTGACAACATTTAAATAATAAAAAAATCTAGTAATTAACAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/IGGP_12x/TTCATTGACAACATT
lang : en | db : IGGP_12x | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.75:28204/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.005 | search_minus_done; http://172.18.8.75:28204/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.084 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).