GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-01-18 17:07:09, GGGenome : Brassica rapa genome, IVFCAASv1 (Aug, 2009)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

A02 dna:chromosome chromosome:IVFCAASv1:A02:1:27846329:1
position: 2711449-2711463
CGTGATGCTGAGGGCCAAGATGTGTTGCTT2711449TTCATTGACAACATTTTCCGATTCACTCAGGTGAGCTATGTTGTT
A10 dna:chromosome chromosome:IVFCAASv1:A10:1:17594535:1
position: 16345303-16345317
CGTGATGCTGAAGGCCAAGATGTGTTGCTT16345303TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCTACTGTGTT
A02 dna:chromosome chromosome:IVFCAASv1:A02:1:27846329:1
position: 2705807-2705821
AACAACATAGCTCACCTGAGTGAATCGGAA2705807AATGTTGTCAATGAAAAGCAACACATCTTGGCCCTCGGCATCACG
A02 dna:chromosome chromosome:IVFCAASv1:A02:1:27846329:1
position: 12745060-12745074
CTACGCTGAATTCTCAAAGAAAAACTTTTG12745060AATGTTGTCAATGAAATCTAAAGCACAAACTAAACATATTCTTTC
A10 dna:chromosome chromosome:IVFCAASv1:A10:1:17594535:1
position: 16337368-16337382
AACACAGTAGCTCACCTGAGTGAAACGGAA16337368AATGTTGTCAATGAAAAGCAACACATCTTGGCCTTCAGCATCACG
Scaffold024314 dna:scaffold scaffold:IVFCAASv1:Scaffold024314:1:125:1
position: 100-114
AACAACATAGCTCACCTGAGTGAATCGGAA100AATGTTGTCAATGAAAAGCAACACAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/IVFCAASv1/TTCATTGACAACATT
lang : en | db : IVFCAASv1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.086 | 0.078 | search_plus_done; http://172.18.8.75:28172/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.091 | 0.006 | search_minus_done; http://172.18.8.75:28172/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.094 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).