GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 09:03:09, GGGenome : Ixodes scapularis genome, IscaW1 (Aug, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

DS706139 dna:scaffold scaffold:IscaW1:DS706139:1:1219:1
position: 15-29
ACTTTCTCCTTTCC15TTCATTGACAACATTAAAAGCTTTGGGGGCAGTTTTATAGTTTGT
DS658723 dna:scaffold scaffold:IscaW1:DS658723:1:83960:1
position: 20524-20538
GTGATATATTTTTTTTATTTTCTTTATAAT20524TTCATTGACAACATTTTTAGACCCTGTACACGGAAGAGTTGTTGA
DS645981 dna:scaffold scaffold:IscaW1:DS645981:1:95347:1
position: 34782-34796
AACATGTCTTTATCTGCACTAACTTAAAAG34782TTCATTGACAACATTTAAGTAATTAAGCGACTTATTTTGAGGATT
DS915257 dna:scaffold scaffold:IscaW1:DS915257:1:308778:1
position: 70203-70217
GGGGTTTCATATCATTTTGTCGAAACACAT70203TTCATTGACAACATTTTATTGACACAAGTTTTATTGATGCTCATG
DS979414 dna:scaffold scaffold:IscaW1:DS979414:1:577972:1
position: 325020-325034
ATTCAAATGAACCTGACGACGTGTCTCGGA325020TTCATTGACAACATTTTAAGTTCTCAAAGACTCAAGAAAACAAAG
DS745361 dna:scaffold scaffold:IscaW1:DS745361:1:1312:1
position: 581-595
CTTTTTCGAGGTTGAAAAATACAGATAGGC581AATGTTGTCAATGAACGAAGGCCTCACGCACGACTGTCTCCAGCC
DS662895 dna:scaffold scaffold:IscaW1:DS662895:1:1347:1
position: 971-985
CCTGCGGTGGCACGAAACTGACGCATCAGT971AATGTTGTCAATGAAACGTTAAGGCCATTTACCTACAGAGCTACG
DS815768 dna:scaffold scaffold:IscaW1:DS815768:1:1992:1
position: 1233-1247
CACTGGCGGATACCATAATGCGGGGCAACA1233AATGTTGTCAATGAATACAAAAACGCCATTCGAGGCAGACGAGAA
DS678110 dna:scaffold scaffold:IscaW1:DS678110:1:15835:1
position: 13555-13569
TCATTTATCCGACAGAATTTGCGCGCACTC13555AATGTTGTCAATGAACGTGGACGAGCGCCCGGTTCCTTCTTTGTG
DS748247 dna:scaffold scaffold:IscaW1:DS748247:1:215944:1
position: 174670-174684
CAAACTATAAAACTGCCCCCAAAGGTTTTT174670AATGTTGTCAATGAAGGAAAGGAGAAAGTTGTTAAATGGAAAGAG
DS886620 dna:scaffold scaffold:IscaW1:DS886620:1:290085:1
position: 99817-99831
TCTTTTTTACAATTAAAACTGAAAAAAACT99817AATGTTGTCAATGAAGCTTCGCAGAACTAGATGGTATGGGACTCC
DS960430 dna:scaffold scaffold:IscaW1:DS960430:1:472160:1
position: 470102-470116
GACGATTTTTCTTAGATATTTTGTGGAATA470102AATGTTGTCAATGAAATATCAAAATTCTAGTTGATTTGCCTTTTA
DS825893 dna:scaffold scaffold:IscaW1:DS825893:1:574972:1
position: 424356-424370
TCGCTTTGCGTTACGTGACGTCAGGGCTTC424356AATGTTGTCAATGAATGTACCATTTATGCTAAAATGCGATTGGAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/IscaW1/TTCATTGACAACATT
lang : en | db : IscaW1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.090 | 0.082 | search_plus_done; http://172.18.8.76:28147/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.106 | 0.016 | search_minus_done; http://172.18.8.76:28147/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.111 | 0.005 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).